Skip to Content
Merck
All Photos(1)

Documents

EHU131981

Sigma-Aldrich

MISSION® esiRNA

targeting human HBP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTGGAGTTGCTGCAGTGTAATGAGAATTTGCCATCTTCACCTGGATATAACTCCTGTGATGAACACATGGAGCTTGATGACCTTCCTGAACTTCAGGCAGTTCAAAGTGATCCTACCCAATCTGGCATGTACCAGCTGAGTTCAGATGTTTCACATCAAGAATACCCAAGATCATCTTGGAACCAAAATACCTCAGACATACCAGAAACTACTTACCGTGAAAATGAGGTGGACTGGCTAACAGAATTGGCAAATATCGCGACCAGTCCACAAAGTCCACTGATGCAGTGCTCATTTTACAATAGATCATCTCCTGTACACATCATAGCCACTAGCAAAAGTTTACATTCCTATGCACGCCCTCCACCAGTGTCCTCTTCTTCGAAGAGTGAACCAGCCTTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiyong Yan et al.
FEBS letters, 588(17), 3038-3046 (2014-06-17)
We found that miR-96 is overexpressed in glioma, and its level inversely correlates with the survival of patients. The reduction in miR-96 abundance suppresses the proliferation and colony formation of glioma cells. The tumorigenicity of U-87 MG cells is reduced
Z Z Yao et al.
Journal of biological regulators and homeostatic agents, 34(2), 357-366 (2020-06-19)
This study aims to explore the effect of p38 mitogen-activated protein kinase and its downstream target HMG-box transcription factor 1 (HBP1) in the chondrocyte (CH) senescence caused by hyperosmotic stress. Human cartilage tissue with or without osteoarthritis (OA) were collected
Ruo-Chia Tseng et al.
Journal of cellular and molecular medicine, 18(9), 1752-1761 (2014-06-05)
β-catenin nuclear accumulation is frequently identified in human non-small cell lung cancer (NSCLC). The HMG-box transcription factor 1 (HBP1) is a known repressor of β-catenin transactivation. However, the role of HBP1 in relation to β-catenin nuclear accumulation has not been

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service