Skip to Content
Merck
All Photos(1)

Key Documents

EHU107481

Sigma-Aldrich

MISSION® esiRNA

targeting human GBP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCATCATCAGATCGTTGCTCAGCTTTACTTCAGGTCATTTTCAGTCCTCTAGAAGAAGAAGTGAAGGCGGGAATTTATTCGAAACCAGGGGGCTATCGTCTCTTTGTTCAGAAGCTACAAGACCTGAAGAAAAAGTACTATGAGGAACCGAGGAAGGGGATACAGGCTGAAGAGATTCTGCAGACATACTTGAAATCCAAGGAGTCTATGACTGATGCAATTCTCCAGACAGACCAGACTCTCACAGAAAAAGAAAAGGAGATTGAAGTGGAACGTGTGAAAGCTGAGTCTGCACAGGCTTCAGCAAAAATGTTGCAGGAAATGCAAAGAAAGAATGAGCAGATGATGGAACAGAAGGAGAGGAGTTATCAGGAACACTTGAAACAACTGACTGAGAAGATGGAGAACGACAGGGTCCAGTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Kun Zhang et al.
Oncotarget, 8(18), 30422-30437 (2017-04-19)
H5N1 avian influenza viruses are a major pandemic concern. In contrast to the highly virulent phenotype of H5N1 in humans and many animal models, guinea pigs do not typically display signs of severe disease in response to H5N1 virus infection.
J Song et al.
European review for medical and pharmacological sciences, 24(10), 5465-5472 (2020-06-05)
Non-small cell lung cancer (NSCLC) is one of the most ordinary cancers worldwide. Recent studies have discovered many oncogenes play vital roles in the tumorigenesis of malignant tumors. The purpose of our study was to uncover the role of GBP1
Arda Halu et al.
eLife, 7 (2018-10-12)
The role of pro-inflammatory macrophage activation in cardiovascular disease (CVD) is a complex one amenable to network approaches. While an indispensible tool for elucidating the molecular underpinnings of complex diseases including CVD, the interactome is limited in its utility as
Motoi Fukumoto et al.
Cancer science, 105(10), 1351-1359 (2014-08-08)
Standard fractionated radiotherapy for the treatment of cancer consists of daily irradiation of 2-Gy X-rays, 5 days a week for 5-8 weeks. To understand the characteristics of radioresistant cancer cells and to develop more effective radiotherapy, we established a series
Ichiko Yamakita et al.
Biochemical and biophysical research communications, 518(2), 266-272 (2019-08-20)
Previously, we identified molecules involved in human invasive lung adenocarcinoma, and guanylate-binding protein 1 (GBP-1) was selected for further analysis. RT-PCR of normal lung and invasive lung adenocarcinoma tissue samples showed that the relative GBP-1 expression levels normalized to GAPDH

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service