Skip to Content
Merck
All Photos(1)

Key Documents

EHU091241

Sigma-Aldrich

MISSION® esiRNA

targeting human GRB2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTCTCACTTTGGTTGGAACTTTAGGGGGTGGGAGGGGGCGTTGGATTTAAAAATGCCAAAACTTACCTATAAATTAAGAAGAGTTTTTATTACAAATTTTCACTGCTGCTCCTCTTTCCCCTCCTTTGTCTTTTTTTTCATCCTTTTTTCTCTTCTGTCCATCAGTGCATGACGTTTAAGGCCACGTATAGTCCTAGCTGACGCCAATAATAAAAAACAAGAAACCAAGTGGGCTGGTATTCTCTCTATGCAAAATGTCTGTTTTAGTTGGAATGACTGAAAGAAGAACAGCTGTTCCTGTGTTCTTCGTATATACACACAAAAAGGAGCGGGCAGGGCCGCTCGATGCCTTTGCTGTTTAGCTTCCTCCAGAGGAGGGGACTTGTAGGAATCTGCCTTCCAGCCCAGACCCCCAGTGTATTTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mathieu J F Crupi et al.
Oncogene, 39(6), 1361-1377 (2019-10-28)
The RET receptor tyrosine kinase plays important roles in regulating cellular proliferation, migration, and survival in the normal development of neural crest derived tissues. However, aberrant activation of RET, through oncogenic mutations or overexpression, can contribute to tumourigenesis, regional invasion
Yueyue Yang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 133, 111056-111056 (2021-01-01)
Pulmonary arterial hypertension (PAH) is a progressive and lethal cardiopulmonary. Pulmonary vascular remodeling (PVR) caused by excessive proliferation and apoptosis resistance of pulmonary artery smooth muscle cells (PASMCs) is the chief pathological feature of PAH. Dioscin is a natural product
Yolaine Cavignac et al.
PloS one, 10(6), e0131614-e0131614 (2015-06-30)
While it is well established that human cytomegalovirus (HCMV) upregulates many cellular proteins and incorporates several of them into its virion, little is known about the functional relevance of such virus-host interactions. Two cellular proteins, Grb2 and DDX3, gained our

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service