Skip to Content
Merck
All Photos(1)

Documents

EHU070111

Sigma-Aldrich

MISSION® esiRNA

targeting human CCNE1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCCTCCAAAGTTGCACCAGTTTGCGTATGTGACAGATGGAGCTTGTTCAGGAGATGAAATTCTCACCATGGAATTAATGATTATGAAGGCCCTTAAGTGGCGTTTAAGTCCCCTGACTATTGTGTCCTGGCTGAATGTATACATGCAGGTTGCATATCTAAATGACTTACATGAAGTGCTACTGCCGCAGTATCCCCAGCAAATCTTTATACAGATTGCAGAGCTGTTGGATCTCTGTGTCCTGGATGTTGACTGCCTTGAATTTCCTTATGGTATACTTGCTGCTTCGGCCTTGTATCATTTCTCGTCATCTGAATTGATGCAAAAGGTTTCAGGGTATCAGTGGTGCGACATAGAGAACTGTGTCAAGTGGATGGTTCCATTTGCCATGGTTATAAGGGAGACGGGGA

Ensembl | human accession no.

ENSG00000105173

NCBI accession no.

NM_001238

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CCNE1(898) , CCNE1(898)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ran Wei et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 38(9), 1952-1964 (2020-03-13)
While amplified expressed cyclin E1 is a well-known tumorigenic factor and prognostic biomarker in several malignancies, its prognostic predictive potential and function in osteosarcoma is poorly understood. Here we reveal discrete expression pattern, correlation to clinicopathological characteristics and prognosis and
Caishang Zheng et al.
Scientific reports, 7(1), 16422-16422 (2017-11-29)
Enterovirus 71 (EV71) is the predominant causative pathogen of hand-foot-and-mouth disease (HFMD). Contrary to other HFMD-causing enterovirus, EV71 can lead to severe neurological complications, even death. MicroRNAs (miRNAs) are small non-coding RNAs that constitute the largest family of gene regulators
X Zhang et al.
Neoplasma, 66(5), 704-716 (2019-05-28)
Previous studies have reported that miR-107 could be utilized as a potential peripheral biomarker in prostate cancer (PCa). However, the specific functions of miR-107 in prostate cancer and its relevant mechanisms are still unknown. The aim of this research was
Wei-Wei Liu et al.
Cancer management and research, 13, 439-447 (2021-01-28)
To explore the regulatory role of miR497-5p-CCNE1 axis in triple-negative breast cancer (TNBC) cells and its predictive value for early diagnosis. Cancer tissue and adjacent tissue samples were collected from 86 patients with TNBC.RT-PCR was used to detect the expression
Pilar Alonso-Lecue et al.
Cell death & disease, 8(6), e2901-e2901 (2017-07-01)
Squamous cell carcinoma (SCC) or epidermoid cancer is a frequent and aggressive malignancy. However in apparent paradox it retains the squamous differentiation phenotype except for very dysplastic lesions. We have shown that cell cycle stress in normal epidermal keratinocytes triggers
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service