Skip to Content
Merck
All Photos(1)

Documents

EHU067731

Sigma-Aldrich

MISSION® esiRNA

targeting human HUWE1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCTTGGGCAAGTCAGTCAGATATACAGATATGGAGAGTGAAGATTACCACTTCTACCAAGGTCTGGTTTATCTGCTGGAAAATGATGTCTCCACACTAGGCTATGACCTCACCTTCAGCACTGAGGTCCAAGAGTTTGGAGTTTGTGAAGTTCGTGACCTCAAACCCAATGGGGCCAACATCTTGGTAACAGAGGAGAATAAGAAGGAGTATGTACACCTGGTATGCCAGATGAGAATGACAGGAGCCATCCGCAAGCAGTTGGCGGCTTTCTTAGAAGGCTTCTATGAGATCATTCCAAAGCGCCTCATTTCCATCTTCACTGAGCAGGAGTTAGAGCTGCTTATATCAGGACTGCCCACCATTGACATCGATGATCTGAAATCCAACACTGAATACCACAAGTACCAGTCCAACTCTATTCAGATCCAGTGGTTCTGGAGAGCATTGCGTTCTTTC

Ensembl | human accession no.

ENSG00000086758

NCBI accession no.

NM_031407

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HUWE1(10075) , HUWE1(10075)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Michael J Friez et al.
BMJ open, 6(4), e009537-e009537 (2016-05-01)
X linked intellectual disability (XLID) syndromes account for a substantial number of males with ID. Much progress has been made in identifying the genetic cause in many of the syndromes described 20-40 years ago. Next generation sequencing (NGS) has contributed to
Lisa J Crawford et al.
Oncogene, 39(27), 5001-5014 (2020-06-12)
Proteasome inhibitors have provided a significant advance in the treatment of multiple myeloma (MM). Consequently, there is increasing interest in developing strategies to target E3 ligases, de-ubiquitinases, and/or ubiquitin receptors within the ubiquitin proteasome pathway, with an aim to achieve
Matthias Bosshard et al.
Scientific reports, 7(1), 15050-15050 (2017-11-10)
Mutations in the HECT, UBA and WWE domain-containing 1 (HUWE1) E3 ubiquitin ligase cause neurodevelopmental disorder X-linked intellectual disability (XLID). HUWE1 regulates essential processes such as genome integrity maintenance. Alterations in the genome integrity and accumulation of mutations have been
Lu Zhang et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(24), 13447-13456 (2020-06-03)
Precisely controlling the activation of transcription factors is crucial for physiology. After a transcription factor is activated and carries out its transcriptional activity, it also needs to be properly deactivated. Here, we report a deactivation mechanism of HIF-1 and several
Dong Yang et al.
Theranostics, 8(13), 3517-3529 (2018-07-22)
Lung cancer is the most frequent cancer type and the leading cause of tumor-associated deaths worldwide. TP53 is an important tumor suppressor gene and is frequently inactivated in lung cancer. E3 ligases targeting p53, such as MDM2, are involved in
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service