Skip to Content
Merck
All Photos(1)

Documents

EHU063531

Sigma-Aldrich

MISSION® esiRNA

targeting human ACO1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACTTTGAGAGCTGCCTTGGAGCCAAGCAAGGATTTAAAGGATTCCAAGTTGCTCCTGAACATCATAATGACCATAAGACCTTTATCTATGATAACACTGAATTCACCCTTGCTCATGGTTCTGTGGTCATTGCTGCCATTACTAGCTGCACAAACACCAGTAATCCGTCTGTGATGTTAGGGGCAGGATTGTTAGCAAAGAAAGCTGTGGATGCTGGCCTGAACGTGATGCCTTACATCAAAACTAGCCTGTCTCCTGGGAGTGGCGTGGTCACCTACTACCTACAAGAAAGCGGAGTCATGCCTTATCTGTCTCAGCTTGGGTTTGACGTGGTGGGCTATGGCTGCATGACCTGCATTGGCAACAGTGGGCCTTTACCTGAACCTGTGGTAGAAGCCATCACACAGGGAGACCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ACO1(48) , ACO1(48)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 2301-2311 (2020-01-08)
Iron is an essential element to all living organisms and plays a vital role in many cellular processes, such as DNA synthesis and energy production. The Mdm2 oncogene is an E3 ligase and known to promote tumor growth. However, the
Filomena Fiorito et al.
PloS one, 8(3), e58845-e58845 (2013-03-23)
Mammalian cells require iron to satisfy metabolic needs or to accomplish specialized functions, and DNA viruses, like bovine herpesvirus 1 (BHV-1), require an iron-replete host to efficiently replicate, so that iron bioavailability is an important component of viral virulence. Cellular
Laura Gonzalez-Sanchez et al.
Carcinogenesis, 41(8), 1113-1122 (2019-11-18)
Precursor T-cell lymphoblastic neoplasms are aggressive malignancies in need for more effective and specific therapeutic treatments. A significant fraction of these neoplasms harbor deletions on the locus 9p21, targeting the tumor suppressor CDKN2A but also deleting the aconitase 1 (ACO1)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service