Skip to Content
Merck
All Photos(1)

Key Documents

EHU063231

Sigma-Aldrich

MISSION® esiRNA

targeting human CDC25A

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
NOK 1,680.00
50 μG
NOK 2,970.00

NOK 1,680.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
NOK 1,680.00
50 μG
NOK 2,970.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

NOK 1,680.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTGTAGCTCCAGCACTCGGTCAGTGTTGAAGAGACCAGAACGATCTCAAGAGGAGTCTCCACCTGGAAGTACAAAGAGGAGGAAGAGCATGTCTGGGGCCAGCCCCAAAGAGTCAACTAATCCAGAGAAGGCCCATGAGACTCTTCATCAGTCTTTATCCCTGGCATCTTCCCCCAAAGGAACCATTGAGAACATTTTGGACAATGACCCAAGGGACCTTATAGGAGACTTCTCCAAGGGTTATCTCTTTCATACAGTTGCTGGGAAACATCAGGATTTAAAATACATCTCTCCAGAAATTATGGCATCTGTTTTGAATGGCAAGTTTGCCAACCTCATTAAAGAGTTTGTTATCATCGACTGTCGATACCCATATGAATACGAGGGAGGCCACATCAAGGGTGCAGTGAACTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiao Gao et al.
Nature communications, 11(1), 3904-3904 (2020-08-09)
A major challenge in chemotherapy is chemotherapy resistance in cells lacking p53. Here we demonstrate that NIP30, an inhibitor of the oncogenic REGγ-proteasome, attenuates cancer cell growth and sensitizes p53-compromised cells to chemotherapeutic agents. NIP30 acts by binding to REGγ
Wenzhe Yin et al.
OncoTargets and therapy, 13, 3689-3701 (2020-05-21)
Colorectal cancer (CRC) is a common malignant tumor in digestive system. Circular RNA (circRNA) circ_0007142 has been identified as an oncogene in CRC. However, the mechanism of circ_0007142 in CRC was rarely reported. The levels of circ_0007142, dedicator of cytokinesis
Yanchao Ma et al.
Journal of Cancer, 11(8), 2158-2170 (2020-03-05)
Colorectal cancer (CRC) is one of the most common malignancies, and chemoresistance is one of the key obstacles in the clinical outcome. Here, we studied the function of B7-H3 in regulating cell cycle-mediated chemoresistance in CRC. The ability of B7-H3
Sarah Bertoli et al.
Oncotarget, 6(35), 38061-38078 (2015-10-31)
We investigated cell cycle regulation in acute myeloid leukemia cells expressing the FLT3-ITD mutated tyrosine kinase receptor, an underexplored field in this disease. Upon FLT3 inhibition, CDC25A mRNA and protein were rapidly down-regulated, while levels of other cell cycle proteins

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service