Skip to Content
Merck
All Photos(1)

Key Documents

EHU060321

Sigma-Aldrich

MISSION® esiRNA

targeting human ALDH1A3, RP11-66B24.4

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
NOK 1,680.00
50 μG
NOK 2,970.00

NOK 1,680.00


Please contact Customer Service for Availability


Select a Size

Change View
20 μG
NOK 1,680.00
50 μG
NOK 2,970.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

NOK 1,680.00


Please contact Customer Service for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGGTCTTTGTGGATTGCATGTTGACATTGACCGTGAGATTCGGCTTCAAACCAATACTGCCTTTGGAATATGACAGAATCAATAGCCCAGAGAGCTTAGTCAAAGACGATATCACGGTCTACCTTAACCAAGGCACTTTCTTAAGCAGAAAATATTGTTGAGGTTACCTTTGCTGCTAAAGATCCAATCTTCTAACGCCACAACAGCATAGCAAATCCTAGGATAATTCACCTCCTCATTTGACAAATCAGAGCTGTAATTCGCTTTAACAAATTACGCATTTCTATCACGTTCACTAACAGCTTATGATAAGTCTGTGTAGTCTTCCTTTTCTCCAGTTCTGTTACCCAATTTAGATTAGTAAAGCGTACACAACTGGAAAGACTGCTGTAATAACACAGCCTTGTTATTTTTAAGTCCTATTTTGATATTAATTTCTGATTAGTTAGTAAATAACACCTGGATTCTATGGAGGACCTCGGTC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Daisuke Yamashita et al.
Molecular cancer therapeutics, 19(5), 1134-1147 (2020-03-05)
The development of efficacious therapies targeting metastatic spread of breast cancer to the brain represents an unmet clinical need. Accordingly, an improved understanding of the molecular underpinnings of central nervous system spread and progression of breast cancer brain metastases (BCBM)
Vita Golubovskaya et al.
Journal of cancer research and clinical oncology, 141(9), 1613-1631 (2015-02-07)
Focal adhesion kinase is an important survival signal in cancer. Recently, we demonstrated that the autophosphorylation inhibitor of FAK, Y15, effectively inhibited cancer cell growth. We detected many cancer cell lines sensitive to Y15 and also detected several cell lines

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service