Skip to Content
Merck
All Photos(1)

Documents

EHU038941

Sigma-Aldrich

MISSION® esiRNA

targeting human BMP7

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGCTACGCCGCCTACTACTGTGAGGGGGAGTGTGCCTTCCCTCTGAACTCCTACATGAACGCCACCAACCACGCCATCGTGCAGACGCTGGTCCACTTCATCAACCCGGAAACGGTGCCCAAGCCCTGCTGTGCGCCCACGCAGCTCAATGCCATCTCCGTCCTCTACTTCGATGACAGCTCCAACGTCATCCTGAAGAAATACAGAAACATGGTGGTCCGGGCCTGTGGCTGCCACTAGCTCCTCCGAGAATTCAGACCCTTTGGGGCCAAGTTTTTCTGGATCCTCCATTGCTCGCCTTGGCCAGGAACCAGCAGACCAACTGCCTTTTGTGAGACCTTCCCCTCCCTATCCCCAACTTTAAAGGTGTGAGAGTATTAGGAAACATGAGCAGCATATGGCTTTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaojun Ji et al.
Biological & pharmaceutical bulletin, 43(3), 533-539 (2020-03-03)
Renal interstitial fibrosis (RIF) is a common pathological characteristic associated with end-stage renal disease. However, treatment strategies for RIF are still very limited. In this study, we reported that kaempferol, a classic flavonoid, exhibited strong and widely inhibitory effect on
Maria Angelica Cortez et al.
Nature communications, 11(1), 4840-4840 (2020-09-26)
Immunotherapies revolutionized cancer treatment by harnessing the immune system to target cancer cells. However, most patients are resistant to immunotherapies and the mechanisms underlying this resistant is still poorly understood. Here, we report that overexpression of BMP7, a member of
Caixia Yuan et al.
Experimental and therapeutic medicine, 17(4), 2547-2556 (2019-03-25)
Bone morphogenetic protein (BMP) expression has been observed in the uterus in previous studies. However, the influence of BMP7 on blastocyst implantation remains unclear. Blastocysts first act on luminal endometrial epithelial cells during implantation. The purpose of the present study

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service