Skip to Content
Merck
All Photos(1)

Documents

EHU034601

Sigma-Aldrich

MISSION® esiRNA

targeting human GPC5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAATGAAGACCACCACAAGGAACAGTGAAGAGACGCTTGCCAACAGAAGAAAAGAATTTATCAACAGCCTTCGACTGTACAGGTCATTCTATGGAGGTCTAGCTGATCAGCTTTGTGCTAATGAATTAGCTGCTGCAGATGGACTTCCCTGCTGGAATGGAGAAGATATAGTAAAAAGTTATACTCAGCGTGTGGTTGGAAATGGAATCAAAGCCCAGTCTGGAAATCCTGAAGTCAAAGTCAAAGGAATTGATCCTGTGATAAATCAGATTATTGATAAACTGAAGCATGTTGTTCAGTTGTTACAGGGTAGATCACCCAAACCTGACAAGTGGGAACTTCTTCAGCTGGGCAGTGGTGGAGGCATGGTTGAACAAGTCAGTGGGGACTGTGATGATGAAGATGGTTGCGGGGGATCAGGAAGTGGAGAAGTCAAGAGGACACTGAAGATCACAGACTGGATGCCAGATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Masao Takeuchi et al.
PloS one, 16(2), e0226538-e0226538 (2021-02-20)
Glypican-5 (GPC5) is a heparan sulfate proteoglycan (HSPG) localized to the plasma membrane. We previously reported that in the human mesenchymal stem cell line UE6E7T-3, GPC5 is overexpressed in association with transformation and promotes cell proliferation by acting as a
Xin Hong et al.
European journal of pharmacology, 854, 39-47 (2019-04-06)
Accumulating evidence has suggested that Glypican-5 (GPC5) is a tumor suppressor gene in many types of cancers. However, whether GPC5 is involved in glioma remains unknown. This study was designed to explore the expression, biological function and regulatory mechanism of
Koji Okamoto et al.
The American journal of pathology, 185(7), 1889-1898 (2015-05-20)
Type 2 diabetes mellitus is a leading health issue worldwide. Among cases of diabetes mellitus nephropathy (DN), the major complication of type 2 diabetes mellitus, the nephrotic phenotype is often intractable to clinical intervention and demonstrates the rapid decline of

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service