Skip to Content
Merck
All Photos(1)

Key Documents

EHU031731

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGER4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCGAGTATTCGTCAACCAGTTATATCAGCCAAGTTTGGAGCGAGAAGTCAGTAAAAATCCAGATTTGCAGGCCATCCGAATTGCTTCTGTGAACCCCATCCTAGACCCCTGGATATATATCCTCCTGAGAAAGACAGTGCTCAGTAAAGCAATAGAGAAGATCAAATGCCTCTTCTGCCGCATTGGCGGGTCCCGCAGGGAGCGCTCCGGACAGCACTGCTCAGACAGTCAAAGGACATCTTCTGCCATGTCAGGCCACTCTCGCTCCTTCATCTCCCGGGAGCTGAAGGAGATCAGCAGTACATCTCAGACCCTCCTGCCAGACCTCTCACTGCCAGACCTCAGTGAAAATGGCCTTGGAGGCAGGAATTTGCTTCCAGGTGTGCCTGGCATGGGCCTGGCCCAGGAAGACACCACCTCACTGAGGACTTTGCGAATATCAGAGACCTCAGACTCTTCACAGGGTCAGGACTCAGA

Ensembl | human accession no.

ENSG00000171522

NCBI accession no.

NM_000958

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PTGER4(5734) , PTGER4(5734)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Felix Tönisen et al.
European journal of cell biology, 96(2), 218-226 (2017-01-18)
The production of Prostaglandin E
Pinki Nandi et al.
BMC cancer, 17(1), 11-11 (2017-01-07)
Lymphatic metastasis, facilitated by lymphangiogenesis is a common occurrence in breast cancer, the molecular mechanisms remaining incompletely understood. We had earlier shown that cyclooxygenase (COX)-2 expression by human or murine breast cancer cells promoted lymphangiogenesis and lymphatic metastasis by upregulating
Sonja Rittchen et al.
Biochemical pharmacology, 182, 114277-114277 (2020-10-11)
Life-threatening inflammatory conditions such as acute respiratory distress syndrome or sepsis often go hand in hand with severe vascular leakage. During inflammation, endothelial cell integrity and intact barrier function are crucial to limit leukocyte and plasma extravasation. Prostaglandin D2 (PGD2)
Dingzhi Wang et al.
Gastroenterology, 149(7), 1884-1895 (2015-08-12)
Inflammation may contribute to the formation, maintenance, and expansion of cancer stem cells (CSCs), which have the capacity for self-renewal, differentiation, and resistance to cytotoxic agents. We investigated the effects of the inflammatory mediator prostaglandin E2 (PGE2) on colorectal CSC

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service