Skip to Content
Merck
All Photos(1)

Key Documents

EHU007971

Sigma-Aldrich

MISSION® esiRNA

targeting human UCP2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGTCTCCCACCCATTTTCTATGGAAAACCAAGGGGATCGGGCCATGATAGCCACTGGCAGCTTTGAAGAACGGGACACCTTTAGAGAAGCTTGATCTTGGAGGCCTCACCGTGAGACCTTACAAAGCCGGATTCCGGCAGAGTTCCTCTATCTCGTCTTGTTGCTGATTAAAGGTGCCCCTGTCTCCAGTTTTTCTCCATCTCCTGGGACGTAGCAGGAAATCAGCATCATGGTTGGGTTCAAGGCCACAGATGTGCCCCCTACTGCCACTGTGAAGTTTCTTGGGGCTGGCACAGCTGCCTGCATCGCAGATCTCATCACCTTTCCTCTGGATACTGCTAAAGTCCGGTTACAGATCCAAGGAGAAAGTCAGGGGCCAGTGCGCGCTACAGCCAGCGCCCAGTACCGCGGTGTGATGGGCACCATTCTGACCATGGTGCGTACTGAGGGCCCCCGAAGCCTCTACAATGGGCTGGTTGCCGGCCTGCAGCGCCAAATGAGCTTTGCCTCTGTCCGCATCGGCCTGTATGATTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Anand Kumar Gupta et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(11), 5087-5101 (2017-08-03)
In visceral leishmaniasis, we found that the antileishmanial drug Amp B produces a higher level of IL-1β over the infected control. Moreover, administering anti-IL-1β antibody to infected Amp B-treated mice showed significantly less parasite clearance. Investigation revealed that
Corina T Madreiter-Sokolowski et al.
Oncotarget, 8(46), 80278-80285 (2017-11-09)
Cancer cells have developed unique strategies to meet their high energy demand. Therefore, they have established a setting of Ca
Jin Hee Lee et al.
Oncology letters, 20(6), 374-374 (2020-11-07)
The uncoupling protein-2 (UCP2) serves a role in tumor aggressiveness and anticancer resistance, which is considered to be associated with its ability to attenuate reactive oxygen species (ROS) production. We hypothesized that UCP2 may protect cancer cells from elesclomol-induced cytotoxicity
Rui Zhang et al.
BioMed research international, 2020, 6537371-6537371 (2020-09-17)
As a common disorder, acute kidney injury (AKI) is characterized by high mortality and morbidity, and current therapeutic options for AKI remain limited. Irisin, a muscle factor, plays an important role in metabolic disorders. However, the role of irisin in
Rebecca F Hough et al.
JCI insight, 4(3) (2019-02-08)
Acid aspiration, which can result from several etiologies, including postoperative complications, leads to direct contact of concentrated hydrochloric acid (HCl) with the alveolar epithelium. As a result, rapid endothelial activation induces alveolar inflammation, leading to life-threatening pulmonary edema. Because mechanisms

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service