Skip to Content
Merck
All Photos(1)

Key Documents

EHU007361

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTGCCCGACTTGAAGGTAGAAGTTCCTTGAAAGAAATAGAACCAAATCTGTTTGCTGATGAAGATTCACCTGTGCATGGTGATATTCTTGAATTTCATGGCCCAGAAGGAACAGGAAAAACAGAAATGCTTTATCACCTAACAGCACGATGTATACTTCCCAAATCAGAAGGTGGCCTGGAAGTAGAAGTCTTATTTATTGATACAGATTACCACTTTGATATGCTCCGGCTAGTTACAATTCTTGAGCACAGACTATCCCAAAGCTCTGAAGAAATAATCAAATACTGCCTGGGAAGATTTTTTTTGGTGTACTGCAGTAGTAGCACCCACTTACTTCTTACACTTTACTCACTAGAAAGTATGTTTTGTAGTCACCCATCTCTCTGCCTTTTGATTTTGGATAGCCTGTCAGCTTTTTACTGGATAGACCGCGTCAATGGAGGAGAAAGTGTGAACTTACAGGAGTCTACTCTGAGGAAATGTTCTCAGTGCTTAGAGAAGCTTGTAAATGACTATCGCCTGGTTCTTTTTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jennifer M Mason et al.
Cancer research, 74(13), 3546-3555 (2014-04-23)
RAD51 is the central protein that catalyzes DNA repair via homologous recombination, a process that ensures genomic stability. RAD51 protein is commonly expressed at high levels in cancer cells relative to their noncancerous precursors. High levels of RAD51 expression can
Zuzana Nascakova et al.
International journal of molecular sciences, 22(7) (2021-05-01)
R-loops are three-stranded structures generated by annealing of nascent transcripts to the template DNA strand, leaving the non-template DNA strand exposed as a single-stranded loop. Although R-loops play important roles in physiological processes such as regulation of gene expression, mitochondrial
Xinzhu Deng et al.
PloS one, 10(6), e0127862-e0127862 (2015-06-30)
Mammalian NOTCH1-4 receptors are all associated with human malignancy, although exact roles remain enigmatic. Here we employ glp-1(ar202), a temperature-sensitive gain-of-function C. elegans NOTCH mutant, to delineate NOTCH-driven tumor responses to radiotherapy. At ≤20°C, glp-1(ar202) is wild-type, whereas at 25°C

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service