Skip to Content
Merck
All Photos(1)

Key Documents

EMU021801

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cxcr4

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTGCCCACCATCTACTTCATCATCTTCTTGACTGGCATAGTCGGCAATGGATTGGTGATCCTGGTCATGGGTTACCAGAAGAAGCTAAGGAGCATGACGGACAAGTACCGGCTGCACCTGTCAGTGGCTGACCTCCTCTTTGTCATCACACTCCCCTTCTGGGCAGTTGATGCCATGGCTGACTGGTACTTTGGGAAATTTTTGTGTAAGGCTGTCCATATCATCTACACTGTCAACCTCTACAGCAGCGTTCTCATCCTGGCCTTCATCAGCCTGGACCGGTACCTCGCCATTGTCCACGCCACCAACAGTCAAAGGCCAAGGAAACTGCTGGCTGAAAAGGCAGTCTATGTGGGCGTCTGGATCCCAGCCCTCCTCCTGACTATACCTGACTTCATCTTTGCCGACGTCAGCCAGGGGGACATCAGTCAGGGGGATGACAG

Ensembl | mouse accession no.

ENSMUSG00000045382

NCBI accession no.

NM_009911

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... CXCR4(12767) , Cxcr4(12767)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

12 - Non Combustible Liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jordy J Hsiao et al.
BMC cancer, 15, 204-204 (2015-04-18)
Identifying cellular signaling pathways that become corrupted in the presence of androgens that increase the metastatic potential of organ-confined tumor cells is critical to devising strategies capable of attenuating the metastatic progression of hormone-naïve, organ-confined tumors. In localized prostate cancers
Dong-Hua Luo et al.
Journal of translational medicine, 11, 203-203 (2013-08-31)
Recent studies have indicated that the expression of endothelin A receptor (ETAR) and chemokine receptor 4 (CXCR4) could be used as an indicator of the metastatic potential of nasopharyngeal carcinoma (NPC). The aim of this study was to determine the
Yan Wang et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 21(11), 1310-1317 (2014-08-31)
C-X-C chemokine receptor type 4 (CXCR4) signaling has been demonstrated to be involved in cancer invasion and migration; therefore, CXCR4 antagonist can serve as an anti-cancer drug by preventing tumor metastasis. This study aimed to identify the CXCR4 antagonists that
Meng-Feng Tsai et al.
Scientific reports, 5, 13574-13574 (2015-09-05)
Malignant pleural effusion (MPE) is a common clinical problem in non-small cell lung carcinoma (NSCLC) patients; however, the underlying mechanisms are still largely unknown. Recent studies indicate that the frequency of the L858R mutant form of the epidermal growth factor
Zhi-Yu Song et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 46-52 (2015-05-12)
Chemokine CXCL12 is an extracellular chemokine, which binds to its cell surface receptor CXCR4. High expressions of CXCR4 and CXCL12 are associated with biological malignant potential in colon cancers. We aimed to investigate the roles of the CXCR4/CXCL12 axis in
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service