Skip to Content
Merck
All Photos(1)

Documents

EHU034701

Sigma-Aldrich

MISSION® esiRNA

targeting human ROCK1 (2)

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGACAGAATCGGACACAGCTGTAAGATTGAGGAAGAGTCACACAGAGATGAGCAAGTCAATTAGTCAGTTAGAGTCCCTGAACAGAGAGTTGCAAGAGAGAAATCGAATTTTAGAGAATTCTAAGTCACAAACAGACAAAGATTATTACCAGCTGCAAGCTATATTAGAAGCTGAACGAAGAGACAGAGGTCATGATTCTGAGATGATTGGAGACCTTCAAGCTCGAATTACATCTTTACAAGAGGAGGTGAAGCATCTCAAACATAATCTCGAAAAAGTGGAAGGAGAAAGAAAAGAGGCTCAAGACATGCTTAATCACTCAGAAAAGGAAAAGAATAATTTAGAGATAGATTTAAACTACAAACTTAAATCATTACAACAACGGTTAGAACAAGAGGTAAATGAACACAAAGTAACCAAAGCTCGTTTAACTGACAAACATCAATCTATTGAAGAGGCAAAGTCTGTGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jialing Rao et al.
Scientific reports, 7, 39727-39727 (2017-01-06)
A recent study demonstrated that advanced glycation end products (AGEs) play a role in monocyte infiltration in mesangial areas in diabetic nephropathy. The Ras homolog gene family, member A Rho kinase (RhoA/ROCK) pathway plays a role in regulating cell migration.
Wen-Di Zhou et al.
International journal of oncology, 51(6), 1831-1841 (2017-10-19)
Actein is a tetracyclic triterpenoid compound, extracted from the rhizome of Cimicifuga foetida, exhibiting anticancer activities as previously reported. However, the effects of actein on human leukemia have not been explored before. In this study, the role of actein in
Dongmei Wang et al.
OncoTargets and therapy, 13, 361-370 (2020-02-06)
Propofol has been identified to perform anti-tumor functions in glioma. However, the molecular mechanisms underlying propofol-induced prevention on migration and invasion of glioma cells remain unclear. Cell proliferation, invasion and migration were measured by 3-(4,5)-dimethylthiahiazo(-z-y1)-3,5-di-phenytetrazoliumromide assay and transwell assay, respectively.
Gentao Fan et al.
Frontiers in bioscience (Landmark edition), 24, 1167-1177 (2019-05-29)
miR-139 has a tumor suppressor effect in many tumors. Here, we examined the suppressive role of this miRNA and its target, ROCK1, in osteosarcoma (OS), a highly malignant bone tumor that mainly affects children and adolescents. The expression of miR-139
Candelas Álvarez-Salamero et al.
PLoS biology, 18(3), e3000646-e3000646 (2020-03-24)
Interleukin 23 (IL-23) triggers pathogenic features in pro-inflammatory, IL-17-secreting T cells (Th17 and Tγδ17) that play a key role in the development of inflammatory diseases. However, the IL-23 signaling cascade remains largely undefined. Here, we used quantitative phosphoproteomics to characterize

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service