Skip to Content
Merck
All Photos(1)

Key Documents

EHU024131

Sigma-Aldrich

MISSION® esiRNA

targeting human KCNN1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCAGCATCTCCTCCTGGATCATCGCAGCCTGGACCGTGCGCGTCTGCGAGAGGTACCACGACAAGCAGGAAGTGACCAGCAACTTCCTGGGGGCCATGTGGCTGATTTCCATCACCTTCCTCTCCATTGGCTACGGCGACATGGTGCCCCACACCTACTGCGGGAAGGGTGTGTGCCTGCTCACTGGCATCATGGGAGCTGGCTGTACCGCGCTCGTGGTGGCTGTGGTGGCTCGGAAGCTGGAGCTCACCAAGGCTGAGAAGCACGTGCACAACTTCATGATGGACACTCAGCTCACCAAGCGGGTAAAAAACGCCGCTGCTAACGTTCTCAGGGAGACGTGGCTCATCTACAAACATACCAGGCTGGTGAAGAAGCCAGACCAAGCCCGGGTTCGGAAACACCAGCGTAAGTTCCTCCAAGCCATCCATCATGGCAGGATGCTCCGGAGTGTGAAGATCGAGCAAGGGAAGCTGAACGACCAGGCTAA

Ensembl | human accession no.

ENSG00000105642

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KCNN1(3780) , KCNN1(3780)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Young-Jin Seo et al.
PloS one, 8(8), e75005-e75005 (2013-10-19)
Influenza continues to pose a threat to humans by causing significant morbidity and mortality. Thus, it is imperative to investigate mechanisms by which influenza virus manipulates the function of host factors and cellular signal pathways. In this study, we demonstrate
Heba Alshaker et al.
Frontiers in pharmacology, 10, 303-303 (2019-04-12)
Sphingosine kinases 1 and 2 (SK1 and SK2) are proto-oncogenic isozymes expressed in many human tumors and associated with chemoresistance and poor prognosis. They are well-recognized therapy targets and their inhibition was shown to induce tumor volume reduction and chemosensitization
Ilari Pulli et al.
Biochimica et biophysica acta, 1853(9), 2173-2182 (2015-04-22)
Caveolae are plasma membrane invaginations enriched in sterols and sphingolipids. Sphingosine kinase 1 (SK1) is an oncogenic protein that converts sphingosine to sphingosine 1-phosphate (S1P), which is a messenger molecule involved in calcium signaling. Caveolae contain calcium responsive proteins, but

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service