Skip to Content
Merck
All Photos(1)

Key Documents

EHU062481

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTCCCTGGCAAGCACTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nicolas Ricard et al.
Cells, 9(1) (2019-12-28)
Despite the clinical importance of arteriogenesis, this biological process is poorly understood. ERK1 and ERK2 are key components of a major intracellular signaling pathway activated by vascular endothelial growth (VEGF) and FGF2, growth factors critical to arteriogenesis. To investigate the
Wei Chen et al.
Cell & bioscience, 7, 43-43 (2017-08-31)
Connexins are a family of transmembrane proteins that form gap junctions, which are important for diffusion of cytosolic factors such as ions and second messenger signaling molecules. Our previous study has shown that Connexin40 (Cx40), one dominant connexin expressed in
Osamu Otabe et al.
Oncology reports, 37(1), 98-104 (2016-11-15)
In alveolar rhabdomyosarcoma (ARMS) that is a highly malignant pediatric soft tissue tumor, MET, a receptor of hepatocyte growth factor (HGF), was reported to be downstream of the PAX3-FOXO1 fusion gene specific to ARMS, and a key mediator of metastatic
Takeshi Koujima et al.
Molecular therapy oncolytics, 17, 107-117 (2020-04-24)
Pancreatic ductal adenocarcinoma (PDAC) cells have an exceptional ability to invade nerves through pronounced crosstalk between nerves and cancer cells; however, the mechanism of PDAC cell invasion remains to be elucidated. Here, we demonstrate the therapeutic potential of telomerase-specific oncolytic
Sangwon Byun et al.
Nature communications, 9(1), 2590-2590 (2018-07-04)
Farnesoid-X-Receptor (FXR) plays a central role in maintaining bile acid (BA) homeostasis by transcriptional control of numerous enterohepatic genes, including intestinal FGF19, a hormone that strongly represses hepatic BA synthesis. How activation of the FGF19 receptor at the membrane is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service