Skip to Content
Merck
All Photos(1)

Key Documents

EHU141461

Sigma-Aldrich

MISSION® esiRNA

targeting human RELA

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCAATGGCTACACAGGACCAGGGACAGTGCGCATCTCCCTGGTCACCAAGGACCCTCCTCACCGGCCTCACCCCCACGAGCTTGTAGGAAAGGACTGCCGGGATGGCTTCTATGAGGCTGAGCTCTGCCCGGACCGCTGCATCCACAGTTTCCAGAACCTGGGAATCCAGTGTGTGAAGAAGCGGGACCTGGAGCAGGCTATCAGTCAGCGCATCCAGACCAACAACAACCCCTTCCAAGTTCCTATAGAAGAGCAGCGTGGGGACTACGACCTGAATGCTGTGCGGCTCTGCTTCCAGGTGACAGTGCGGGACCCATCAGGCAGGCCCCTCCGCCTGCCGCCTGTCCTTTCTCATCCCATCTTTGACAATCGTGCCCCCAACACTGCCGAGCTCAAGAT

Ensembl | human accession no.

ENSG00000173039

NCBI accession no.

NM_001145138

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RELA(5970) , RELA(5970)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xu Wang et al.
Journal of cellular and molecular medicine, 21(12), 3420-3434 (2017-06-24)
Catalase is an antioxidative enzyme that converts hydrogen peroxide (H
Ichiro Yajima et al.
Archives of toxicology, 91(11), 3507-3516 (2017-05-05)
Chronic exposure to arsenic is associated with various diseases in humans. Skin hyperpigmentation is the most sensitive objective symptom for patients with arsenicosis. However, there is very limited information about the mechanism of arsenic-mediated skin hyperpigmentation in vivo. In this
Xiu-Lei Zhang et al.
Biochimica et biophysica acta. General subjects, 1863(10), 1443-1457 (2019-05-20)
Lung cancer is the leading cause of global cancer deaths. Current chemotherapeutic agents for lung cancer treatment are generally accompanied with severe side effects. Here, we report that marchantin C (Mar-C), a potential natural compound with little chemotherapeutic toxicity, exerts
Masayuki Hiraki et al.
Signal transduction and targeted therapy, 3, 13-13 (2018-05-16)
B-cell lymphoma 2-related protein A1 (BCL2A1) is a member of the BCL-2 family of anti-apoptotic proteins that confers resistance to treatment with anti-cancer drugs; however, there are presently no agents that target BCL2A1. The MUC1-C oncoprotein is aberrantly expressed in
Zhi-Yuan Li et al.
Aging, 8(10), 2337-2354 (2016-10-08)
The corneal epithelium plays important roles in the maintenance of corneal transparency for good vision, and acts as a protective barrier against foreign insults. Structural and functional changes with aging in the corneal epithelium have been documented. Here we found
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service