Skip to Content
Merck
All Photos(1)

Key Documents

EMU072881

Sigma-Aldrich

MISSION® esiRNA

targeting mouse 1190002h23rik

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00


Estimated to ship on01 June 2025



Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00


Estimated to ship on01 June 2025


description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCGCCACTTCCACTATGAGGAGCACCTAGAGCGCATGAAGCGGCGCAGCAGCGCCAGCATCAGCAACAGCAGCGGCTTCAGCGACTCGGAGAGTGCAGACTCAGTGTACAGGGACAGCTTCACCTTCAGTGATGAGAAGCTGAATTCTCCAACCAACTCCTCTCCAGCTCTCCTGCCCTCCGCTGTCACTCCTCGGAAAGCCAAATTAGGTGACACTAAAGAGCTCGAAGACTTCATTGCCGATCTGGACAGGACCTTAGCAAGTATGTGAAGCAAGGAGTTTGGGGTCCAGAAGGCTCCGAGGACCTGGCAAATCGGCTACTAGAATCTGCTGTGGAAGAGAGCAGAGCTAAGACTCCTGCCCCCTGACCATTCTTAGTTCACTATAACATTAGCCATTGGGCCCATCTCTGGGCAGTTCGGAGAGTGAAGCT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

ACTRIMS-ECTRIMS MSBoston 2014: Poster Sessions 2.
Multiple sclerosis (Houndmills, Basingstoke, England), 20(1 Suppl), 285-496 (2014-09-11)
Ran Xu et al.
Molecular and cellular biochemistry, 394(1-2), 109-118 (2014-05-17)
Response gene to complement 32 (RGC32) is a novel protein originally identified as a cell cycle activator and has been demonstrated to be overexpressed in a variety of human malignancies, including lung cancer. However, the potential role of RGC32 in
Peng Zhao et al.
Cellular & molecular immunology, 12(6), 692-699 (2014-11-25)
Response gene to complement 32 (RGC-32) is a cell cycle regulator involved in the proliferation, differentiation and migration of cells and has also been implicated in angiogenesis. Here we show that RGC-32 expression in macrophages is induced by IL-4 and

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service