Skip to Content
Merck
All Photos(1)

Documents

EMU071921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stat1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGACGACCCTAAGCGAACTGGATACATCAAGACTGAGTTGATTTCTGTGTCTGAAGTCCACCCTTCTAGACTTCAGACCACAGACAACCTGCTTCCCATGTCTCCAGAGGAGTTTGATGAGATGTCCCGGATAGTGGGCCCCGAATTTGACAGTGTGATGAGCACAGTATAAACACGAATTTCTCTCTGGCGACATTTTTTTCCCATCTGTGATTCCTTCCTGCTACTGTTCCTTCATATGCAGTATTTCTAGGGAAATGCAAGAAAGAAAGAGCATCACATTTGCTGAGCACTGCTGGTAGAAAGTGGATATTTCTCTAATTAGAAACCTGTTACTCTGAAGGACTTCATGCATCTTACTGAAGGTGAAATGGAAAGTCACTTAACACAAAATGGATTTTGTAAACAAAGACCAAGAGATCCACCCAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

6-Dehydrogingerdione restrains lipopolysaccharide-induced inflammatory responses in RAW 264.7 macrophages.
Huang SH, Lee CH, Wang HM, et al.
Journal of Agricultural and Food Chemistry, 62(37), 9171-9179 (2014)
EunBin Kong et al.
Cell death and differentiation, 27(8), 2517-2530 (2020-03-05)
Autophagy is a cellular catabolic process that maintains intracellular homeostasis using lysosomal degradation systems. We demonstrate that inhibiting autophagy by depleting essential autophagy elongation proteins, Atg5 or Atg7, induces ISG15 expression through STING-mediated cytosolic dsDNA response. Genome stability is impaired
Takashi Shimizu et al.
Science signaling, 14(667) (2021-01-28)
Pulmonary arterial hypertension (PAH) is a fatal disease characterized by excessive pulmonary vascular remodeling. However, despite advances in therapeutic strategies, patients with PAH bearing mutations in the bone morphogenetic protein receptor type 2 (BMPR2)-encoding gene present severe phenotypes and outcomes.
Chaoyong He et al.
Nature communications, 6, 7770-7770 (2015-07-18)
Platelet-derived growth factor (PDGF) is a mitogen and chemoattractant for vascular smooth muscle cells (VSMCs). However, the direct effects of PDGF receptor β (PDGFRβ) activation on VSMCs have not been studied in the context of atherosclerosis. Here we present a
Huachen Gan et al.
Scientific reports, 5, 17916-17916 (2015-12-09)
Influenza A virus (IAV) targets airway epithelial cells and exploits the host cell machinery to replicate, causing respiratory illness in annual epidemics and pandemics of variable severity. The high rate of antigenic drift (viral mutation) and the putative antigenic shift

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service