Skip to Content
Merck
All Photos(1)

Key Documents

EMU066761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fyb

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00

Estimated to ship on06 May 2025

All Photos(1)

Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00

Estimated to ship on06 May 2025

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCCTCAGACTTCCCTCCTCCACCTGCAGAGATGAGTCAAGGAATGAGTGTTGGAAGGGCAAAAACGGAAGAGAAAGATCCCAAGAAGCTAAAAAAGCAAGAAAAGGAAGAAAAAGACCTCAGGAAAAAATTTAAGTACGACGGTGAAATTCGAGTTCTATATTCAACTAAAGTTGCGTCCTCCTTAACCTCTAAAAAGTGGGGAGCGAGAGATCTGCAGATAAAACCTGGGGAGTCACTCGAAGTTATACAAAGCACAGATGACACCAAAGTTCTCTGCAGGAATGAAGAGGGCAAATATGGTTATGTCCTTCGGAGTTACCTGGTGGACAATGATGGAGAAATCTATGACGACATCGCTGATGGTTGCATCTATGACAATGACTAGCACTCTGCTCTGTTCATTCCACTGTGCC

Ensembl | mouse accession no.

ENSMUSG00000022148

NCBI accession no.

NM_011815

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... FYB(23880) , Fyb(23880)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number
XIS
AOR

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Search for a COA

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mahmoud A Chawsheen et al.
Cellular signalling, 81, 109934-109934 (2021-02-06)
Lung cancer has a poor prognosis partly due to a lack of response to treatments such as the chemotherapy drug gemcitabine. Combinations of chemotherapy drugs with signal transduction inhibitors may be more effective treatments. In this study we have investigated
Fang Wang et al.
Folia histochemica et cytobiologica, 58(2), 96-107 (2020-06-27)
Growing evidence indicates that Rictor (Rapamycin-insensitive companion of mTOR) is overexpressed across several malignancies and associated with poor survival. However, only limited data indicate that Rictor plays a role in gastric cancer (GC). We sought to explore the prognostic value
Li Feng et al.
Pharmaceutical biology, 57(1), 586-594 (2019-09-08)
Context: Evidence suggests that microRNA (miRNA) regulate gene expression and bone tissue homoeostasis of osteoporosis. MiR-152 has found to be abnormally expressed in osteoporosis, but its role in osteoblast differentiation has not been elucidated. Objective: To understand the potential mechanism
Zhaoming Lu et al.
Acta pharmaceutica Sinica. B, 10(6), 1004-1019 (2020-07-10)
Dysregulation of mTORC1/mTORC2 pathway is observed in many cancers and mTORC1 inhibitors have been used clinically in many tumor types; however, the mechanism of mTORC2 in tumorigenesis is still obscure. Here, we mainly explored the potential role of mTORC2 in
Yang Liu et al.
Cancers, 12(4) (2020-04-01)
Isocitrate dehydrogenase (IDH) mutations are common genetic abnormalities in lower grade gliomas. The neomorphic enzyme activity of IDH mutants leads to tumor formation through epigenetic alteration, dysfunction of dioxygenases, and metabolic reprogramming. However, it remains elusive as to how IDH
View All Related Papers

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service