Skip to Content
Merck
All Photos(1)

Key Documents

EMU056631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ift88

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00


Estimated to ship on31 May 2025



Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00


Estimated to ship on31 May 2025


description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGAAGCTGAACCGTCTGGATGAAGCCCTGGACTCCTTCCTGAAACTGCACGCGATCCTTCGGAACAGCGCTCAAGTTCTTTGCCAGATAGCAAACATATATGAGTTAATGGAAGATCCCAATCAAGCTATTGAATGGCTGATGCAGTTGATCAGCGTTGTTCCAACTGATTCCCAAGCTCTGTCTAAACTGGGAGAGTTATACGATAGTGAGGGAGACAAGTCCCAGGCATTCCAATATTACTATGAGTCATACAGGTATTTCCCTTCTAACATTGAAGTCATTGAATGGCTTGGAGCTTATTACATTGATACACAGTTCTGCGAGAAAGCCATTCAGTACTTTGAAAGAGCTTCCCTTATACAACCCACTCAAGTGAAGTGGCAGCTGATGGTAGCTAGCTGCTTTAGAAGAAGTGGTAACTACCAAAAGGCATTAGATACTTATAAAGAGATTCACAGGAAATTTCCGGAGAATGTTGAATGTTTGCGTTTCTTGGTTCGT

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Makiri Kawasaki et al.
Journal of cellular physiology, 230(11), 2788-2795 (2015-04-02)
Ift88 is an intraflagella transport protein, critical for the cilium, and has been shown to be required for the maintenance of chondrocytes and cartilage. However, how Ift88 is controlled by cytokines that play a role in osteoarthritis is not well
Lei Wang et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 309(7), R757-R766 (2015-08-14)
The present study tested whether primary cilia on macula densa serve as a flow sensor to enhance nitric oxide synthase 1 (NOS1) activity and inhibit tubuloglomerular feedback (TGF). Isolated perfused macula densa was loaded with calcein red and 4,5-diaminofluorescein diacetate

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service