Skip to Content
Merck
All Photos(1)

Documents

EMU026571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hmox1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCTCGAATGAACACTCTGGAGATGACACCTGAGGTCAAGCACAGGGTGACAGAAGAGGCTAAGACCGCCTTCCTGCTCAACATTGAGCTGTTTGAGGAGCTGCAGGTGATGCTGACAGAGGAACACAAAGACCAGAGTCCCTCACAGATGGCGTCACTTCGTCAGAGGCCTGCTAGCCTGGTGCAAGATACTGCCCCTGCAGAGACACCCCGAGGGAAACCCCAGATCAGCACTAGCTCATCCCAGACACCGCTCCTCCAGTGGGTCCTCACTCTCAGCTTCCTGTTGGCAACAGTGGCAGTGGGAATTTATGCCATGTAAATGCAATACTGGCCCCCAGGGGCTGTGAACTCTGTCCAATGTGGCCTTCTCTCTGTAAGGGAGAATCTTGCCTGGCTCTCTTCTCTTGGGCCTCTAAGAAAGCTTTTGGGGTCCCTAGCCCACTCCCTGTGTTTC

Ensembl | mouse accession no.

ENSMUSG00000005413

NCBI accession no.

NM_010442

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... HMOX1(15368) , Hmox1(15368)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Gi Soo Youn et al.
Toxicology and applied pharmacology, 280(1), 42-52 (2014-07-30)
HIV-1 Tat causes extensive neuroinflammation that may progress to AIDS-related encephalitis and dementia. Celastrol possesses various biological activities such as anti-oxidant, anti-tumor, and anti-inflammatory activities. In this study, we investigated the modulatory effects of celastrol on HIV-1 Tat-induced inflammatory responses
Xiao Qiao Wang et al.
Biomedical and environmental sciences : BES, 27(10), 786-793 (2014-10-25)
To assess the effect of atorvastatin on lipopolysaccharide (LPS)-induced TNF-α production in RAW264.7 macrophages. RAW264.7 macrophages were treated in different LPS concentrations or at different time points with or without atorvastatin. TNF-α level in supernatant was measured. Expressions of TNF-α
So Ra Kim et al.
Biochemical pharmacology, 95(4), 279-289 (2015-04-22)
High mobility group box 1 (HMGB1) is now recognized as a late mediator of sepsis. We tested hypothesis that ascorbic acid (AscA) induces heme oxygenase (HO)-1 which inhibits HMGB1 release in lipopolysaccharide (LPS)-stimulated cells and increases survival of septic mice.
Yun-Jeong Choe et al.
International journal of oncology, 44(3), 761-768 (2013-12-25)
A recent study reported that p53 can induce HO-1 by directly binding to the putative p53 responsive element in the HO-1 promoter. In this study, we report that nutlin-3, a small molecule antagonist of HDM2, induces the transcription of HO-1
Li-Chin Sung et al.
Clinical and experimental pharmacology & physiology, 42(6), 632-639 (2015-05-02)
Lycopene is the most potent active antioxidant among the major carotenoids, and its use has been associated with a reduced risk for cardiovascular disease (CVD). Endothelin-1 (ET-1) is a powerful vasopressor synthesized by endothelial cells and plays a crucial role
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service