Skip to Content
Merck
All Photos(1)

Key Documents

EHU133121

Sigma-Aldrich

MISSION® esiRNA

targeting human RBM3

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00


Estimated to ship on05 May 2025



Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00


Estimated to ship on05 May 2025


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGCACCGAAGCATCTTATTTTATAGTATATCAACCTTTTGTTTTTAAATTGACCTGCCAAGGTAGCTGAAGACCTTTTAGACAGTTCCATCTTTTTTTTTAAATTTTTTCTGCCTATTTAAAGACAAATTATGGGACGTTTGTAGAACCTGAGTATTTTTCTTTTTACCAGTTTTTTAGTTTGAGCTCTTAGGTTTATTGGAGCTAGCAATAATTGGTTCTGGCAAGTTTGGCCAGACTGACTTCAAAAAATTAATGTGTATCCAGGGACATTTTAAAAACCTGTACACAGTGTTTATTGTGGTTAGGAAGCAATTTCCCAATGTACCTATAAGAAATGTGCATCAAGCCAGCCTGACCAACATGGTGAAACCCCATCTGTACTAAACATAAAAAAATTAGCCTGGCATGGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhiming Cui et al.
Journal of molecular neuroscience : MN, 54(2), 252-263 (2014-03-29)
Hypoxia and other adverse conditions are usually encountered by rapidly growing cells. The RNA-binding motif protein 3 (RBM3) is induced by low temperature and hypoxia. However, its expression and function in spinal cord injury are still unclear. To investigate the
Delphine Laustriat et al.
Molecular therapy. Nucleic acids, 4, e262-e262 (2015-11-04)
Major physiological changes are governed by alternative splicing of RNA, and its misregulation may lead to specific diseases. With the use of a genome-wide approach, we show here that this splicing step can be modified by medication and demonstrate the

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service