Skip to Content
Merck
All Photos(1)

Key Documents

EHU124361

Sigma-Aldrich

MISSION® esiRNA

targeting human UNC5B

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00


Check Cart for Availability


Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00


Check Cart for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTGTTAGAGGGCCCAGAGTTCCTTCTCCACCCCCGCTCTCTCTCTCTTGGCCTGAGATCTCTGTGCAGGAACCAAGATGGGGCTGAAGCCTCTGGAGGCAGTTGGTTGGGGGCGGGCAGGCAGGAGGCCCTCCCTCCACCCCCCCACCCTCAGCCCGGCAACTTCTGGGTTCCATGGGTTTTAGTTCCGTTCTCGTTTTCTTCCTCCGTTATTGATTTCTCCTTTCTCCCTAAGCCCCCTTCTGCTTCCACGCCCTTTTCCTCTTTGAAGAGTCAAGTACAATTCAGACAAACTGCTTTCTCCTGTCCAAAAGCAAAAAGGCAAAGGAAAGAAAGAAAGCTTCAGACCGCTAGTAAGGCTCAAAGAAGAAGAAAAACACCAAAACCACAAGGGAAAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zongyi Xie et al.
Brain, behavior, and immunity, 69, 190-202 (2017-11-23)
Neuroinflammation is an essential mechanism involved in the pathogenesis of subarachnoid hemorrhage (SAH)-induced brain injury. Recently, Netrin-1 (NTN-1) is well established to exert anti-inflammatory property in non-nervous system diseases through inhibiting infiltration of neutrophil. The present study was designed to
Bo Wang et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 34(5), 939-954 (2019-01-16)
Normal bone mass is maintained by balanced bone formation and resorption. Myosin X (Myo10), an unconventional "myosin tail homology 4-band 4.1, ezrin, radixin, moesin" (MyTH4-FERM) domain containing myosin, is implicated in regulating osteoclast (OC) adhesion, podosome positioning, and differentiation in
Junhui Chen et al.
Journal of cellular and molecular medicine, 23(3), 2256-2262 (2019-01-08)
Netrin-1 (NTN-1) is a novel drug to alleviate early brain injury following subarachnoid haemorrhage (SAH). However the molecular mechanism of NTN-1-mediated protection against early brain injury following SAH remains largely elusive. This study aims to evaluate the effects and mechanisms
Feng Zhang et al.
Nature communications, 7, 13517-13517 (2016-11-25)
Vascular permeability and neovascularization are implicated in many diseases including retinopathies and diabetic wound healing. Robo4 is an endothelial-specific transmembrane receptor that stabilizes the vasculature, as shown in Robo4
Dan Liu et al.
BMC ophthalmology, 14, 102-102 (2014-08-26)
Netrin-1 has been reported to promote retinal neovascularization in oxygen-induced retinopathy (OIR). However, netrin-1 receptors, which may mediate netrin-1 action during retinal neovascularization, have not been characterized. In this study, we investigated netrin-1 receptor subtype expression and associated changes in

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service