Skip to Content
Merck
All Photos(1)

Documents

EHU111851

Sigma-Aldrich

MISSION® esiRNA

targeting human USP8

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAATTTGTTGGGGCATAAAGGTGAAGTGGCAGAAGAATTTGGTATAATCATGAAAGCCCTGTGGACAGGACAGTATAGATATATCAGTCCAAAGGACTTTAAAATCACCATTGGGAAGATCAATGACCAGTTTGCAGGATACAGTCAGCAAGATTCACAAGAATTGCTTCTGTTCCTAATGGATGGTCTCCATGAAGATCTAAATAAAGCTGATAATCGGAAGAGATATAAAGAAGAAAATAATGATCATCTCGATGACTTTAAAGCTGCAGAACATGCCTGGCAGAAACACAAGCAGCTCAATGAGTCTATTATTGTTGCACTTTTTCAGGGTCAATTCAAATCTACAGTACAGTGCCTCACATGTCACAAAAAGTCTAGGACATTTGAGGCCTTCATG

Ensembl | human accession no.

ENSG00000138592

NCBI accession no.

NM_005154

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... USP8(9101) , USP8(9101)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinghui Zhang et al.
Biochimica et biophysica acta. General subjects, 1864(12), 129701-129701 (2020-08-21)
Background Organic anion transporter 1 (OAT1) plays a vital role in avoiding the potential toxicity of various anionic drugs through the involvement of kidney elimination. We previously demonstrated that ubiquitin conjugation to OAT1 led to OAT1 internalization from cell surface
Tania Martins-Marques et al.
Life science alliance, 3(12) (2020-10-25)
Ischemic heart disease has been associated with an impairment on intercellular communication mediated by both gap junctions and extracellular vesicles. We have previously shown that connexin 43 (Cx43), the main ventricular gap junction protein, assembles into channels at the extracellular
Hong Peng et al.
Autophagy, 16(4), 698-708 (2019-06-27)
SQSTM1/p62 (sequestosome 1) is a critical macroautophagy/autophagy receptor that promotes the formation and degradation of ubiquitinated aggregates. SQSTM1 can be modified by ubiquitination, and this modification modulates its autophagic activity. However, the molecular mechanisms underpinning its reversible deubiquitination have never
Soyeon Shin et al.
Cell death and differentiation, 27(4), 1341-1354 (2019-09-19)
Notch, an essential factor in tissue development and homoeostasis, has been reported to play an oncogenic function in a variety of cancers. Here, we report ubiquitin-specific protease 8 (USP8) as a novel deubiquitylase of Notch1 intracellular domain (NICD). USP8 specifically

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service