Skip to Content
Merck
All Photos(1)

Key Documents

EHU060921

Sigma-Aldrich

MISSION® esiRNA

targeting human FAF1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00


Check Cart for Availability


Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00


Check Cart for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCAACGTGTTCTGCTCACAAATGCTTTGTGCTGAATCCATTGTTTCTTATCTGAGTCAAAATTTTATAACCTGGGCTTGGGATCTGACAAAGGACTCCAACAGAGCAAGATTTCTCACTATGTGCAATAGACACTTTGGCAGTGTTGTGGCACAAACCATTCGGACTCAAAAAACGGATCAGTTTCCGCTTTTCCTGATTATTATGGGAAAGCGATCATCTAATGAAGTGTTGAATGTGATACAAGGGAACACAACAGTAGATGAGTTAATGATGAGACTCATGGCTGCAATGGAGATCTTCACAGCCCAACAACAGGAAGATATAAAGGACGAGGATGAACGTGAAGCCAGAGAAAATGTGAAGAGAGAGCAAGATGAGGCCTATCGCCTTTCACTTGAGGCTGACAGAGCAAAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Soonhwa Song et al.
Molecular and cellular biology, 36(7), 1136-1151 (2016-01-27)
This study is designed to examine the cellular functions of human Fas-associated factor 1 (FAF1) containing multiple ubiquitin-related domains. Microarray analyses revealed that interferon-stimulated genes related to the antiviral response are significantly increased in FAF1-knockdown HeLa cells. Silencing FAF1 enhanced
NLRP2 and FAF1 deficiency blocks early embryogenesis in the mouse.
Hui Peng et al.
Reproduction (Cambridge, England), 154(3), 145-151 (2017-06-21)
Pauline G Knox et al.
The Journal of cell biology, 192(3), 391-399 (2011-02-02)
CD40, a tumor necrosis factor (TNF) receptor family member, is widely recognized for its prominent role in the antitumor immune response. The immunostimulatory effects of CD40 ligation on malignant cells can be switched to apoptosis upon disruption of survival signals

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service