Skip to Content
Merck
All Photos(1)

Documents

EHU028201

Sigma-Aldrich

MISSION® esiRNA

targeting human NDUFA13

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTCTGGGCAAAAGAGGAGTAAAGACCCCTCAGCTGCAGCCCGGCAGCGCATTCCTACCCAGGGTCCGCCGCCAGAGCTTTCCCGCGCGGTCGGATAGTTACACTACTGTCCGGGACTTCCTAGCCGTGCCGCGGACCATCTCAAGTGCTTCCGCCACACTCATCATGGCGGTGGCAGTAAGTCACTTCCGCCCGGGACCGGAAGTGTGGGATACTGCGAGTATGGCGGCGTCAAAGGTGAAGCAGGACATGCCTCCGCCGGGGGGCTATGGGCCCATCGACTACAAACGGAACTTGCCGCGTCGAGGACTGTCGGGCTACAGCATGCTGGCCATAGGGATTGGAACCCTGATCTACGGGCACTGGAGCATAATGAAGTGGAACCGTGAGCGCAGGCGCCTACAAATCGAGGACTTCGAGGCTCGCATCGCGCTGTTGCCACTGTTACAGGCAGAAACCGACCGGAGGACCTTGCAGATGCTTC

Ensembl | human accession no.

ENSG00000130288

NCBI accession no.

NM_015965

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NDUFA13(51079) , NDUFA13(51079)

Related Categories

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yi Huang et al.
Oncotarget, 7(27), 41404-41420 (2016-05-12)
Aberrant STAT3 activation occurs in most human gastric cancers (GCs) and contributes to the malignant progression of GC, but mechanism(s) underlying aberrant STAT3 remain largely unknown. Here we demonstrated that the gene associated with retinoid interferon-induced mortality 19 (GRIM-19) was
Jung-Hee Kim et al.
Frontiers in microbiology, 8, 576-576 (2017-04-27)
Gene-associated with retinoid-interferon-induced mortality 19 (GRIM-19) targets multiple signaling pathways involved in cell death and growth. However, the role of GRIM-19 in the pathogenesis of hepatitis virus infections remains unexplored. Here, we investigated the restrictive effects of GRIM-19 on the
JooYeon Jhun et al.
Cells, 10(1) (2021-01-21)
Obesity, a condition characterized by excessive accumulation of body fat, is a metabolic disorder related to an increased risk of chronic inflammation. Obesity is mediated by signal transducer and activator of transcription (STAT) 3, which is regulated by genes associated
Ping Cui et al.
Cellular signalling, 71, 109598-109598 (2020-03-14)
Recent evidence has demonstrated that the signal transducer and activator of transcription 3 (STAT3) gene are abnormally active in glioblastoma multiforme (GBM), and this change is crucial for the tumor survival and chemotherapy-resistant. Certain preclinical pharmacology studies have focused on
Na Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 95, 1169-1176 (2017-09-21)
The gene associated with retinoid-interferon-induced mortality-19 (GRIM-19) has been identified as a tumor suppressor in many human cancers. However, little is known about the role of GRIM-19 in cutaneous squamous cell carcinoma (CSCC). Here, we aimed to investigate the potential
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service