Skip to Content
Merck
All Photos(1)

Key Documents

EHU024901

Sigma-Aldrich

MISSION® esiRNA

targeting human CCNB1

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00


Check Cart for Availability


Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00


Check Cart for Availability

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGTGTCACTGCCATGTTTATTGCAAGCAAATATGAAGAAATGTACCCTCCAGAAATTGGTGACTTTGCTTTTGTGACTGACAACACTTATACTAAGCACCAAATCAGACAGATGGAAATGAAGATTCTAAGAGCTTTAAACTTTGGTCTGGGTCGGCCTCTACCTTTGCACTTCCTTCGGAGAGCATCTAAGATTGGAGAGGTTGATGTCGAGCAACATACTTTGGCCAAATACCTGATGGAACTAACTATGTTGGACTATGACATGGTGCACTTTCCTCCTTCTCAAATTGCAGCAGGAGCTTTTTGCTTAGCACTGAAAATTCTGGATAATGGTGAATGGACACCAACTCTACAACATTACCTGTCATATACTGAAGAATCTCTTCTTCCAGTTATGCAGCACCTGGCTAAGAATGTAGTCATGGTAAATCAAGGACTTACAAAGCACATGACTGTCAAGAACAAGTATGCCACATCGAAGCATG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinglan Jin et al.
Frontiers in bioengineering and biotechnology, 8, 54-54 (2020-03-07)
Hepatocellular carcinoma (HCC) is one of the important types of liver cancer. LncRNA is an important regulatory factor that regulates many biological processes such as tumor cells during tumorigenesis and metastasis. LINC00346 has been associated with various types of liver
Min Li et al.
World journal of gastroenterology, 27(10), 939-958 (2021-03-30)
Hepatocellular carcinoma (HCC) is one of the most prevalent cancers in human populations worldwide. Huanglian decoction is one of the most important Chinese medicine formulas, with the potential to treat cancer. To investigate the role and mechanism of Huanglian decoction
Daniel Hayward et al.
The Journal of cell biology, 218(4), 1182-1199 (2019-01-25)
Spindle checkpoint signaling is initiated by recruitment of the kinase MPS1 to unattached kinetochores during mitosis. We show that CDK1-CCNB1 and a counteracting phosphatase PP2A-B55 regulate the engagement of human MPS1 with unattached kinetochores by controlling the phosphorylation status of

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service