Skip to Content
Merck
All Photos(1)

Key Documents

EHU015511

Sigma-Aldrich

MISSION® esiRNA

targeting human PLG

Sign Into View Organizational & Contract Pricing

Select a Size

20 μG
RM 1,248.00
50 μG
RM 2,221.00

RM 1,248.00


Check Cart for Availability


Select a Size

Change View
20 μG
RM 1,248.00
50 μG
RM 2,221.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

RM 1,248.00


Check Cart for Availability

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTCCACTTCTCCCCACAGACCTAGATTCTCACCTGCTACACACCCCTCAGAGGGACTGGAGGAGAACTACTGCAGGAATCCAGACAACGATCCGCAGGGGCCCTGGTGCTATACTACTGATCCAGAAAAGAGATATGACTACTGCGACATTCTTGAGTGTGAAGAGGAATGTATGCATTGCAGTGGAGAAAACTATGACGGCAAAATTTCCAAGACCATGTCTGGACTGGAATGCCAGGCCTGGGACTCTCAGAGCCCACACGCTCATGGATACATTCCTTCCAAATTTCCAAACAAGAACCTGAAGAAGAATTACTGTCGTAACCCCGATAGGGAGCTGCGGCCTTGGTGTTTCACCACCGACCCCAACAAGCGCTGGGAACTTTGTGACATCCCCCGCTGCACAACACCTCCACCATCTTCTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Lan-Zhi Wang et al.
Developmental and comparative immunology, 106, 103598-103598 (2019-12-28)
Interleukin 18 (IL-18), a member of IL-1 cytokine superfamily, is an important proinflammatory cytokine with multiple functions in both innate immunity and acquired immunity. However, the characteristics and functional roles of IL-18 remain largely unknown in amphibians, which were classed
Liuping Wei et al.
Cellular signalling, 26(7), 1476-1488 (2014-03-25)
We have established that 15-hydroxyeicosatetraenoic acid is an important factor in regulation of pulmonary vascular remodeling (PVR) associated with hypoxia-induced pulmonary hypertension (PH), which is further metabolized by 15-hydroxyprostaglandin dehydrogenase (15-PGDH) to form 15-ketoeicosatetraenoic acid (15-KETE). However, the role of
Uttam Satyal et al.
ACS applied materials & interfaces, 9(35), 29481-29495 (2017-08-16)
This article presents the synthesis, self-assembly, and biological activity as transfection agents for pDNA, siRNA, and mRNA of novel pyridinium pseudogemini surfactants, interfacially engineered from the most efficient gemini surfactants and lipids generated in our amphiphile research program. Formulation of
Karen A Newell-Litwa et al.
The Journal of cell biology, 210(2), 225-242 (2015-07-15)
RhoGTPases organize the actin cytoskeleton to generate diverse polarities, from front-back polarity in migrating cells to dendritic spine morphology in neurons. For example, RhoA through its effector kinase, RhoA kinase (ROCK), activates myosin II to form actomyosin filament bundles and

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service