Skip to Content
Merck
All Photos(1)

Documents

EHU003641

Sigma-Aldrich

MISSION® esiRNA

targeting human PGRMC1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTGGATAAGGAAGCACTGAAGGATGAGTACGATGACCTTTCTGACCTCACTGCTGCCCAGCAGGAGACTCTGAGTGACTGGGAGTCTCAGTTCACTTTCAAGTATCATCACGTGGGCAAACTGCTGAAGGAGGGGGAGGAGCCCACTGTGTACTCAGATGAGGAAGAACCAAAAGATGAGAGTGCCCGGAAAAATGATTAAAGCATTCAGTGGAAGTATATCTATTTTTGTATTTTGCAAAATCATTTGTAACAGTCCACTCTGTCTTTAAAACATAGTGATTACAATATTTAGAAAGTTTTGAGCACTTGCTATAAGTTTTTTAATTAACATCACTAGTGACACTAATAAAATTAACTTCTTAGAATGCATGATGTGTTTGTGTGTCACAAATCCAGAAAGTGAACTGCAGTGCTGTAATACACATGTTAATACTGTTTTTCTTCTATCTGTAGTTAGTACAGGATGAATTTAAATGTGTTTTTCCTGAGAGACAAGGAAGACTTGGGTATTTCCCAAAACAGGTAAAAATCTTAAATGTGCACCAAGAGCAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Diego A Pedroza et al.
British journal of cancer, 123(8), 1326-1335 (2020-07-25)
Increased expression of the progesterone receptor membrane component 1 (PGRMC1) has been linked to multiple cancers, including breast cancer. Despite being a regulatory receptor and a potential therapeutic target, the oncogenic potential of PGRMC1 has not been studied. The impact
Domenica Roberto et al.
The Prostate, 79(15), 1777-1788 (2019-09-11)
Gleason grade is among the most powerful clinicopathological classification systems used to assess risk of lethal potential in prostate cancer, yet its biologic basis is poorly understood. Notably, pure low-grade cancers, comprised predominantly of Gleason pattern 3 (G3) are typically
Ying Lin et al.
Scientific reports, 10(1), 4748-4748 (2020-03-18)
In non-small-cell lung cancer, mutation of epidermal growth factor receptor (EGFR) stimulates cell proliferation and survival. EGFR tyrosine kinase inhibitors (EGFR-TKIs) such as erlotinib are used as first-line therapy with drastic and immediate effectiveness. However, the disease eventually progresses in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service