Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

HSTUD0046

Sigma-Aldrich

MISSION® Synthetic microRNA Inhibitor, Human

hsa-miR-1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
12352200
NACRES:
NA.51

Línea del producto

MISSION®

Formulario

solid

secuencia madura

UGGAAUGUAAAGAAGUAUGUAU

Nº de acceso Sanger mature/minor

Nº de acceso Sanger microRNA

temp. de almacenamiento

−20°C

Descripción general

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.[1] This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

  • Long lasting inhibition at very low dosage
  • Excellent resistance to cellular nucleases
  • Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

Otras notas

Based on miRBase V19

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Pictogramas

Health hazard

Palabra de señalización

Warning

Frases de peligro

Consejos de prudencia

Clasificaciones de peligro

STOT RE 2 Inhalation

Órganos de actuación

Respiratory Tract

Código de clase de almacenamiento

11 - Combustible Solids

Clase de riesgo para el agua (WGK)

WGK 3

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico