HLMIR2668
MISSION® Lenti microRNA, Human
hsa-miR-7110-3p
About This Item
Línea del producto
MISSION®
Formulario
liquid
concentración
≥1x106 VP/ml (via p24 assay)
secuencia madura
UCUCUCUCCCACUUCCCUGCAG
Nº de acceso Sanger mature/minor
Nº de acceso Sanger microRNA
Condiciones de envío
dry ice
temp. de almacenamiento
−70°C
Descripción general
Lentiviral transduction particles are produced from sequence-verified lentiviral plasmid vectors. Oligos containing the microRNA sequences are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. The polymerase II promoter, elongation factor 1 alpha (EF1A), was chosen to drive miRNA expression needed for reverse transcription of viral RNA and integration of viral DNA into the host cell genome. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory element allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells. Unlike murine-based MMLV or MSCV retroviral systems, lentiviral-based particles permit efficient infection and integration of the specific miRNA construct into differentiated and non-dividing cells, such as neurons and dendritic cells.
Otras notas
Productos recomendados
Información legal
control
Código de clase de almacenamiento
12 - Non Combustible Liquids
Clase de riesgo para el agua (WGK)
WGK 3
Punto de inflamabilidad (°F)
Not applicable
Punto de inflamabilidad (°C)
Not applicable
Elija entre una de las versiones más recientes:
Certificados de análisis (COA)
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.
Si necesita más asistencia, póngase en contacto con Atención al cliente
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Active Filters
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico