Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU208521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Emr1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGTGTGATGACACATGTCCTTTGAATTCATCATGTACCAACACTATTGGGAGCTACTTCTGCACTTGCCACCCTGGCTTTGCATCTAGCAATGGACAGCTGAATTTCAAAGACCTAGAGGTGACATGTGAAGATATTGATGAGTGCACCCAAGATCCATTACAATGTGGACTGAATTCTGTCTGCACCAATGTACCAGGCTCCTACATCTGTGGCTGCCTCCCTGACTTTCAAATGGATCCAGAAGGCTCCCAAGGATATGGAAACTTCAACTGCAAAAGGATCCTCTTCAAGTGTAAGGAAGACTTGATACTCCAAAGTGAGCAGATACAGCAATGCCAAGCAGTGCAGGGCAGGGATCTTGGTTATGCTTCCTTCTGTACACTTGTGAATGCTACCTTCACAATCCTTGATAATACCTGTGAGAACAAAAGTGCCCCAGTGTCCTTACAGAGTGCAGCTACAAGTGTCTCCCTCGTGCTGGAGCAAGCGACCACATGGTTTGAGCTCAGCA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Michael J Hansen et al.
Inflammation research : official journal of the European Histamine Research Society ... [et al.], 64(9), 697-706 (2015-07-08)
Adipose tissue macrophages (ATMs) have been implicated in a number of obesity-related diseases. Because the activated macrophages associated with many types of autoimmune and inflammatory diseases express a folate receptor (FR) that can be exploited for FR-targeted drug delivery, we
Takako Serizawa et al.
Infection and immunity, 84(2), 562-572 (2015-12-09)
Histopathological changes of the gastric mucosa after Helicobacter pylori infection, such as atrophy, metaplasia, and dysplasia, are considered to be precursors of gastric cancer, yet the mechanisms of histological progression are unknown. The aim of this study was to analyze
Fabiana N Soki et al.
Oncotarget, 6(34), 35782-35796 (2015-10-16)
Resident macrophages in bone play important roles in bone remodeling, repair, and hematopoietic stem cell maintenance, yet their role in skeletal metastasis remains under investigated. The purpose of this study was to determine the role of macrophages in prostate cancer
Chiyoko Sekine et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(10), 2751-2761 (2014-06-20)
We previously reported that blockade of the Notch ligand delta-like protein 1 (DLL-1) suppressed osteoclastogenesis and ameliorated arthritis in a mouse model of rheumatoid arthritis (RA). However, the mechanisms by which joint inflammation were suppressed have not yet been revealed.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico