Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU205321

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nme2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AACGGTTCGAGCAGAAGGGGTTCCGCCTGGTGGCCATGAAGTTCCTTCGGGCCTCTGAAGAACACCTGAAGCAGCATTACATCGACCTGAAAGACCGTCCTTTCTTCCCGGGGCTGGTGAAGTACATGAACTCGGGGCCCGTGGTGGCCATGGTCTGGGAGGGGCTCAATGTGGTGAAAACGGGCCGAGTGATGCTGGGGGAGACCAATCCAGCTGATTCAAAACCAGGCACCATCCGTGGGGATTTCTGCATTCAAGTTGGCAGGAACATCATTCATGGCAGTGATTCAGTGGAGAGTGCTGAGAAAGAGATCCATCTGTGGTTTAAGCCCGAAGAACTGATCGACTACAAGTCTTGTGCCCATGACTGGGTGTACGAGTAGACATGAAGAAACCAGAATCCTTTTCAGCACTACTGATGGGTTTCTGGACAGAGCTCTTCATCCCACTGACAGGATGGATCATCTTTTCTAAAACAATAAAGA

Ensembl | nº de acceso | ratón

ENSMUSG00000020857

Nº de acceso NCBI

NM_008705

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... NME2(18103) , Nme2(18103)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
JFS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Natasha T Snider et al.
The Journal of cell biology, 195(2), 217-229 (2011-10-19)
Genetic factors impact liver injury susceptibility and disease progression. Prominent histological features of some chronic human liver diseases are hepatocyte ballooning and Mallory-Denk bodies. In mice, these features are induced by 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) in a strain-dependent manner, with the C57BL
Xinjiang Cai et al.
Molecular biology of the cell, 25(8), 1244-1250 (2014-02-14)
The kidney, together with bone and intestine, plays a crucial role in maintaining whole-body calcium (Ca(2+)) homoeostasis, which is primarily mediated by altering the reabsorption of Ca(2+) filtered by the glomerulus. The transient receptor potential-vanilloid-5 (TRPV5) channel protein forms a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico