Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU204481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Abcc3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGCTGGGCTCCAAGTTCTGGGACTCCAACCTGTCTATATATACCAACACTCCGGACCTCACACCCTGTTTCCAGAACTCCTTGCTGGCCTGGGTCCCCTGCATCTACCTGTGGGCTGCCTTGCCCTGCTACCTGTTTTACCTGAGACACCATCAGCTCGGCTACATAGTCCTCTCATGGTTATCCAGGCTCAAGACGGCCCTCGGTGTTCTGCTGTGGTGTGTCTCATGGGTGGACCTGTTCTATTCCTTCCACGGCCTGATCCATGGCTCATCCCCTGCTCCTGTCTTCTTTGTCACACCCTTGGTGGTGGGGATCACCATGCTGCTGGCCACTTTGCTAATCCAGTACGAGCGGCTTCGGGGGGTACAGTCTTCGGGAGTGCTCATCATATTCTGGCTCCTGTGTGTGATCTGTGCCATCATCCCCTTCCGTTCCAAGATCCTCTCAGCTTTGGCAGA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yu-Qin Pan et al.
Biopharmaceutics & drug disposition, 36(4), 232-244 (2015-01-20)
Previous work has indicated that there is increased protein expression of multidrug resistance-associated protein 3 (MRP3) in the liver samples of patients treated with omeprazole compared with those who were not. However, evidence is still lacking to show the mechanisms

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico