Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU153941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ncl

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGGCAGAAATTGATGGACGATCTGTTTCACTCTACTATACTGGAGAGAAAGGTCAAAGGCAAGAGAGAACTGGAAAGACCAGCACTTGGAGTGGTGAATCAAAGACTTTGGTTTTAAGTAACCTTTCCTACAGTGCAACAAAAGAAACTCTTGAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTGCCCCAGAACCCACATGGCAAACCTAAAGGGTATGCATTTATAGAATTTGCTTCATTTGAAGATGCTAAAGAAGCTTTAAATTCCTGTAATAAAATGGAAATTGAGGGCAGAACAATCAGGCTGGAGTTGCAAGGATCCAATTCGAGAAGTCAACCATCCAAAACTCTGTTTGTCAAAGGTCTGTCTGAGGATACCACTGAAGAGACCTTAAAAGAATCATTTGAGGGCTCTGTTCGTGCAAGAATAGTCACTGATCGGGAAACTGGTTCTTCCAAAGGGTTTGGTTTTGTAGACTTTAATAGTGAGGAAGATGCCAAAGCT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

San-Cher Chen et al.
Oncotarget, 6(18), 16253-16270 (2015-05-06)
Hepatoma-derived growth factor (HDGF) overexpression is involved in liver fibrosis and carcinogenesis. However, the receptor(s) and signaling for HDGF remain unclear. By using affinity chromatography and proteomic techniques, nucleolin (NCL) was identified and validated as a HDGF-interacting membrane protein in
Dario Palmieri et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(30), 9418-9423 (2015-07-15)
Nucleolin (NCL) is a nucleocytoplasmic protein involved in many biological processes, such as ribosomal assembly, rRNA processing, and mRNA stabilization. NCL also regulates the biogenesis of specific microRNAs (miRNAs) involved in tumor development and aggressiveness. Interestingly, NCL is expressed on

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico