Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU093231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Akr1b7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACCCTTATCTCACCCAGGAAAAACTGATCCAATACTGTCAATCCAAGGGCATCGCTGTTACAGCCTACAGTCCCCTGGGCTCCCCAGACAGGCCTTATGCCAAGCCAGAAGACCCCGTAGTAATGGAGATTCCCAAGATCAAAGAGATTGCTGCAAAACACAAGAAAACAGTAGCTCAGGTTCTGATTCGGTTCCATGTCCAAAGGAATGTGGTGGTGATCCCCAAGTCTGTGACACCCTCACGCATACAGGAGAACCTGCAGGTCTTCGACTTCCAGTTGAGTGAGGAGGACATGGCTGCCATTCTCAGCTTCAACAGGAACTGGAGGGCCTGTGACCTGTTGGATGCAAGGACTGAAGAGGACTATCCTTTCCACGAGGAATACTGAGGTCCACTTGCTTGATGAGATCCGTGCATGAT

Ensembl | nº de acceso | ratón

ENSMUSG00000052131

Nº de acceso NCBI

NM_009731

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... AKR1B7(11997) , Akr1b7(11997)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tao Shan et al.
Cancer science, 105(7), 847-856 (2014-05-13)
Norepinephrine and epinephrine, catecholamine hormones that are major mediators for chronic stress-induced cancers, are implicated in the progression of a number of cancer cells, including gastric adenocarcinoma. However, the underlying mechanisms of these hormones have not been well elucidated. Epithelial-mesenchymal
Luofu Wang et al.
PloS one, 9(5), e96586-e96586 (2014-05-07)
The objective of this study was to investigate nanobubbles carrying androgen receptor (AR) siRNA and their in vitro and in vivo anti-tumor effects, when combined with ultrasonic irradiation, on androgen-independent prostate cancer (AIPC). Nanobubbles carrying AR siRNA were prepared using
Xiaolong Du et al.
Experimental biology and medicine (Maywood, N.J.), 240(11), 1472-1479 (2015-05-15)
Angiogenesis is critical to wound repair due to its role in providing oxygen and nutrients that are required to support the growth and function of reparative cells in damaged tissues. Adenosine receptors are claimed to be of paramount importance in
Fan Sun et al.
Journal of cellular physiology, 230(11), 2640-2646 (2015-02-03)
Adrenoreceptors (ARs) are widely expressed and play essential roles throughout the body. Different subtype adrenoceptors elicit distinct effects on cell proliferation, but knowledge remains scarce about the subtype-specific effects of β2-ARs on the proliferation of embryonic pluripotent stem (PS) cells
Xianwei Li et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 19(5), 401-411 (2015-09-04)
Aldose reductase (AR) is known to play a crucial role in the mediation of diabetic and cardiovascular complications. Recently, several studies have demonstrated that allergen-induced airway remodeling and ovalbumin-induced asthma is mediated by AR. Epalrestat is an aldose reductase inhibitor
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico