Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU087911

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mef2d

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACTCCTTCCCTGGTGACATCATCCCTTACGGACCCACGGCTCCTGTCCCCCCAGCAGCCAGCACTACAGAGAAACAGTGTTTCTCCAGGCTTGCCCCAGCGGCCTGCTAGTGCAGGAGCCATGCTGGGTGGAGACCTCAACAGTGCTAATGGAGCCTGCCCCAGCCCCGTTGGGAATGGCTATGTCAGTGCCCGAGCTTCCCCTGGCCTCCTCCCTGTGGCCAATGGCAACAGCCTAAACAAAGTCATCCCTGCCAAGTCTCCGCCCCCACCCACCCACAACACCCAGCTTGGAGCCCCCAGCCGCAAGCCTGATCTGCGGGTCATCACTTCCCAGGGAGGCAAAGGGTTAATGCATCATTTGAACAATGCCCAGCGCCTTGGGGTCTCCCAGTCTACCCACTCGCTCACCACCCCAGTGGTTTCCGTGGCAACACCAAGTTTACTCAGCCAGGGCCTCCCCTTCTCCTCCATGCCCACTGCCTACAACACAGATTACCAGCTGCCCAGTGCAGAGCTATCCTCC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jung-Hwa Han et al.
Life sciences, 135, 1-8 (2015-06-03)
bFGF is a potent mitogen of cells associated with fibrosis. Although ERK5 has been reported to play roles in the development of fibrosis, its roles in regulating bFGF-induced fibrotic responses are not understood, especially in lung fibroblasts. The authors investigated
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico