Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU070381

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cbl

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Fecha estimada de envío06 de mayo de 2025



Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Fecha estimada de envío06 de mayo de 2025


descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACCCTGGTTACATGGCTTTCCTGACATACGATGAAGTGAAAGCGCGCCTGCAGAAGTTCATCCACAAACCTGGCAGTTACATCTTTCGGCTGAGCTGTACTCGTTTGGGTCAGTGGGCTATTGGGTATGTTACTGCCGATGGGAACATTCTGCAGACAATCCCACACAATAAACCGCTCTTCCAAGCACTGATTGATGGCTTCAGGGAAGGCTTCTATTTGTTTCCTGATGGACGAAATCAAAATCCTGACCTGACAGGTTTATGTGAACCAACTCCTCAAGATCATATCAAAGTAACCCAGATATGTGCTGAGAATGATAAGGATGTGAAGATTGAGCCCTGTGGACACCTCATGTGCACATCCTGCCTCACGTCGTGGCAGGAATCAGAAGGTCAGGGCTGTCCTTTTTGCCGATGTGAAATCA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chirayu Pandya et al.
Psychoneuroendocrinology, 45, 108-118 (2014-05-23)
Brain derived neurotrophic factor (BDNF) signaling through its receptor TrkB plays a crucial role in neurodevelopment and plasticity. Stress and glucocorticoids have been shown to alter TrkB signaling in neurons, and defects in TrkB expression have been reported in the
Y Gui et al.
Oncogene, 34(46), 5718-5728 (2015-03-03)
Suppressor of cytokine signaling 1 (SOCS1) is considered as a tumor suppressor protein in hepatocellular carcinoma (HCC), but the underlying mechanisms remain unclear. Previously, we have shown that SOCS1-deficient hepatocytes displayed increased responsiveness to hepatocyte growth factor (HGF) due to

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico