Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU056631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ift88

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGAAGCTGAACCGTCTGGATGAAGCCCTGGACTCCTTCCTGAAACTGCACGCGATCCTTCGGAACAGCGCTCAAGTTCTTTGCCAGATAGCAAACATATATGAGTTAATGGAAGATCCCAATCAAGCTATTGAATGGCTGATGCAGTTGATCAGCGTTGTTCCAACTGATTCCCAAGCTCTGTCTAAACTGGGAGAGTTATACGATAGTGAGGGAGACAAGTCCCAGGCATTCCAATATTACTATGAGTCATACAGGTATTTCCCTTCTAACATTGAAGTCATTGAATGGCTTGGAGCTTATTACATTGATACACAGTTCTGCGAGAAAGCCATTCAGTACTTTGAAAGAGCTTCCCTTATACAACCCACTCAAGTGAAGTGGCAGCTGATGGTAGCTAGCTGCTTTAGAAGAAGTGGTAACTACCAAAAGGCATTAGATACTTATAAAGAGATTCACAGGAAATTTCCGGAGAATGTTGAATGTTTGCGTTTCTTGGTTCGT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Makiri Kawasaki et al.
Journal of cellular physiology, 230(11), 2788-2795 (2015-04-02)
Ift88 is an intraflagella transport protein, critical for the cilium, and has been shown to be required for the maintenance of chondrocytes and cartilage. However, how Ift88 is controlled by cytokines that play a role in osteoarthritis is not well
Lei Wang et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 309(7), R757-R766 (2015-08-14)
The present study tested whether primary cilia on macula densa serve as a flow sensor to enhance nitric oxide synthase 1 (NOS1) activity and inhibit tubuloglomerular feedback (TGF). Isolated perfused macula densa was loaded with calcein red and 4,5-diaminofluorescein diacetate

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico