Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU056201

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mapk7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TATCATCGCCATCAAGGACATCCTGAAGCCTACTGTGCCCTATGGAGAATTCAGATCTGTCTATGTGGTACTGGACCTCATGGAGAGCGACCTACACCAGATCATTCACTCTTCACAGCCGCTCACCCTGGAACATGTGAGATACTTCCTGTACCAGCTGCTTCGGGGCCTCAAATACATGCACTCTGCTCAGGTCATCCACCGTGATCTTAAACCCTCTAACCTTCTGGTCAATGAGAACTGTGAGCTCAAGATCGGTGACTTTGGAATGGCCCGTGGCCTCTGTACTTCCCCTGCCGAGCACCAGTACTTCATGACTGAGTATGTGGCTACTCGCTGGTACCGTGCCCCGGAGCTCATGCTTTCCCTGCACGAGTATACGCAGGCAATCGACCTCTGGTCTGTGGGCTGCATCTTTGGTGAGATGCTGGCTCGGCGCCAGCTCTTCCCAGGCAAAAACTACGTGCACCAGTTACAGCTGATCATGATGGTGTTGG

Ensembl | mouse accession no.

ENSMUSG00000001034

NCBI accession no.

NP_035971

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... MAPK7(23939) , Mapk7(23939)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yufeng Zuo et al.
Journal of cellular biochemistry, 116(1), 124-132 (2014-08-28)
Members of Rho family GTPases including Cdc42 are known to play pivotal roles in cell migration. Cell migration is also known to be regulated by many protein kinases. Kinetworks KPSS 11.0 phospho-site screening of Cdc42-silenced Hs578T breast cancer cells revealed
Paul R Gavine et al.
BMC cancer, 15, 454-454 (2015-06-05)
MAPK7/ERK5 (extracellular-signal-regulated kinase 5) functions within a canonical three-tiered MAPK (mitogen activated protein kinase) signaling cascade comprising MEK (MAPK/ERK kinase) 5, MEKK(MEK kinase) 2/3 and ERK5 itself. Despite being the least well studied of the MAPK-modules, evidence supports a role
Jin Jiang et al.
Molecular and cellular biochemistry, 406(1-2), 237-243 (2015-05-16)
Bone cells respond to various mechanical stimuli including fluid shear stress (FSS) in vitro. Induction of cyclooxygenase-2 (COX-2) is thought to be important for the anabolic effects of mechanical loading. Recently, extracellular-signal-regulated kinase 5 (ERK5) has been found to be
Uyen B Chu et al.
Biochimica et biophysica acta, 1850(7), 1415-1425 (2015-04-02)
Statins are potent inhibitors of cholesterol biosynthesis and are clinically beneficial in preventing cardiovascular diseases, however, the therapeutic utility of these drugs is limited by myotoxicity. Here, we explored the mechanism of statin-mediated activation of ERK5 in the human endothelium

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico