Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU055771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Aurkb

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGAAGTTGGCTGAGAACAAGAGTCAGGGCTCCACTGCCTCGCAAGGATCCCAGAACAAGCAGCCTTTCACTATTGACAACTTTGAGATTGGGCGTCCTTTGGGCAAAGGCAAATTTGGAAACGTGTACTTGGCTCGGGAGAAGAAGAGCCGTTTCATCGTGGCACTCAAGATCCTCTTCAAGTCTCAGATTGAGAAGGAGGGGGTAGAGCACCAGCTTCGCCGAGAGATCGAAATCCAGGCGCACCTGAAACATCCCAACATCCTTCAACTCTACAACTACTTCTACGACCAGCAGAGGATCTACTTAATCCTGGAATACGCCCCTCGCGGGGAACTCTACAAGGAACTGCAGAAGAGTCGGACCTTCGATGAGCAGCGGACTGCCACGATCATGGAGGAACTGTCAGATGCCCTGACCTACTGCCACAAGAAGAAGGTAATTCACAGAGACATAAAGCCGGAGAACCTGCTGTTAGGTCTGCAGGGAG

Ensembl | mouse accession no.

ENSMUSG00000020897

NCBI accession no.

NP_035626

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... AURKB(20877) , Aurkb(20877)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Antonio Madejón et al.
Journal of hepatology, 63(2), 312-319 (2015-03-04)
Chronic hepatitis C is a leading cause of chronic liver disease, cirrhosis and hepatocellular carcinoma. DNA methylation and histone covalent modifications constitute crucial mechanisms of genomic instability in human disease, including liver fibrosis and hepatocellular carcinoma. The present work studies
Kazuharu Kai et al.
Molecular cancer therapeutics, 14(12), 2687-2699 (2015-10-08)
Currently, no targeted drug is available for triple-negative breast cancer (TNBC), an aggressive breast cancer that does not express estrogen receptor, progesterone receptor, or HER2. TNBC has high mitotic activity, and, because Aurora A and B mitotic kinases drive cell
Lijuan Zhu et al.
The Journal of biological chemistry, 290(45), 27053-27066 (2015-09-18)
Mitotic chromosome segregation is orchestrated by the dynamic interaction of spindle microtubules with the kinetochores. During chromosome alignment, kinetochore-bound microtubules undergo dynamic cycles between growth and shrinkage, leading to an oscillatory movement of chromosomes along the spindle axis. Although kinetochore
Aarthi Jayanthan et al.
PloS one, 9(7), e102741-e102741 (2014-07-23)
Leukemia is the most common pediatric malignancy, constituting more than 30% of all childhood cancers. Although cure rates have improved greatly, approximately one in five children relapse and poor survival rates post relapse remain a challenge. Given this, more effective

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico