Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU054211

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00

Check Cart for Availability
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00

Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATTCGCGTGGATAAGGAGTTCTCTGGTGTGCCCTGGAACTCACACGACATCTTCCAGTACCAAGACAAAGCCTATTTCTGCCATGGCAAATTCTTCTGGCGTGTGAGTTTCCAAAATGAGGTGAACAAGGTGGACCATGAGGTGAACCAGGTGGACGACGTGGGCTACGTGACCTACGACCTCCTGCAGTGCCCTTGAACTAGGGCTCCTTCTTTGCTTCAACCGTGCAGTGCAAGTCTCTAGAGACCACCACCACCACCACCACACACAAACCCCATCCGAGGGAAAGGTGCTAGCTGGCCAGGTACAGACTGGTGATCTCTTCTAGAGACTGGGAAGGAGTGGAGGCAGGCAGGGCTCTCTCTGCCCACCGTCCTTTCTTGTTGGACTGTTTCTAATAAACACGGATCCCCAACCTTTTCCAGCTACTTTAGTCAATCAGCTTATCTGTAGTTGCAGATGCATCCGAG

Ensembl | nº de acceso | ratón

ENSMUSG00000017737

Nº de acceso NCBI

NM_013599

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... MMP9(17395) , Mmp9(17395)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
RJU
IBS
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Pauli Puolakkainen et al.
Medical oncology (Northwood, London, England), 31(3), 884-884 (2014-02-15)
Patients with chronic pancreatitis with local inflammation have high risk for pancreatic cancer. The aim of this study was to examine the role of the inflammatory cells in the invasion of pancreatic cancer cells, focusing on the involvement of a
Shan Lu et al.
Journal of cellular physiology, 230(8), 1862-1870 (2014-12-30)
MicroRNA-520c (miR-520c) and microRNA-373 (miR-373) are originally characterized as both oncogenes and tumor suppressors in different types of human cancers. In this study, we found that translation of mRNA of MT1-MMP, an oncogene related to tumor metastasis, was well inhibited
Ming-Ju Hsieh et al.
British journal of pharmacology, 171(12), 3037-3050 (2014-03-20)
High mortality and morbidity rates for hepatocellular carcinoma in Taiwan primarily result from uncontrolled tumour metastasis. Glabridin, a prenylated isoflavonoid of licorice (Glycyrrhiza glabra) roots, is associated with a wide range of biological properties, such as regulation of energy metabolism, oestrogenic
Yang Yu et al.
Biochemical and biophysical research communications, 463(3), 285-291 (2015-05-25)
Preeclampsia is a devastating pregnancy-related syndrome characterized by the onset of hypertension, proteinuria and edema. Insufficient invasion of trophoblasts is well-known to be correlated with preeclampsia development. The present study was performed to investigate the functional role microRNA (miRNA)-204 in
Hongmei Yu et al.
Experimental cell research, 333(1), 127-135 (2015-02-24)
Mucus hypersecretion is the key manifestation in patients with chronic inflammatory airway diseases and mucin 5AC (MUC5AC) is a major component of airway mucus. Matrix metalloproteinases (MMP)-9, have been found to be involved in the pathogenesis of inflammatory airway diseases.

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico