Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU051691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Hspa5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

MXP 5,935.00


Check Cart for Availability


Seleccione un Tamaño

Cambiar Vistas
20 μG
MXP 5,935.00
50 μG
MXP 10,600.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

MXP 5,935.00


Check Cart for Availability

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGCGACAAGCAACCAAAGATGCTGGCACTATTGCTGGACTGAATGTCATGAGGATCATCAATGAGCCTACAGCAGCTGCTATTGCATATGGCCTGGATAAGAGAGAGGGAGAGAAGAACATCCTTGTGTTTGACCTGGGTGGCGGCACCTTCGATGTGTCTCTTCTCACCATTGACAATGGTGTCTTTGAAGTGGTGGCCACTAATGGAGATACTCACCTGGGTGGGGAAGACTTTGATCAGCGGGTCATGGAACACTTCATCAAGTTGTACAAAAAGAAAACTGGTAAAGATGTTAGGAAAGACAACAGAGCTGTGCAGAAACTCCGGCGTGAGGTAGAAAAGGCTAAGAGAGCCTTGTCTTCTCAGCATCAAGCAAGGATTGAAATTGAGTCCTTCTTCGAAGGAGAAGACTTCTCAGAGACCCTTACTCGGGCCAAATTTGA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xia Jiang et al.
Oncology reports, 32(6), 2343-2348 (2014-10-22)
The present study examined the expression of glucose‑regulated protein 78 (GRP78/Bip) in human pancreatic cancer cell lines and the effect of knockdown of GRP78 on the cleavage of poly(ADP-ribose) polymerase (PARP). Human pancreatic cancer cell lines (KP-2, MIAPaCa-2, Panc-1 and
Han Na Suh et al.
Journal of cellular physiology, 229(10), 1557-1568 (2014-03-05)
The aim of this study is to determine whether GlcN could recover the endoplasmic reticulum (ER) stress-induced dysfunction of Na(+) /glucose cotransporter (SGLT) in renal proximal tubule cells (PTCs) under hypoxia. With the rabbit model, the renal ischemia induced tubulointerstitial

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico