Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU031691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Casp8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCAAATGAAATCCACGAGATTCTAGAAGGCTACCAAAGCGCAGACCACAAGAACAAAGACTGCTTCATCTGCTGTATCCTATCCCACGGTGACAAGGGTGTCGTCTATGGAACGGATGGGAAGGAGGCCTCCATCTATGACCTGACATCTTACTTCACTGGTTCAAAGTGCCCTTCCCTGTCTGGGAAACCCAAGATCTTTTTCATTCAGGCTTGCCAAGGAAGTAACTTCCAGAAAGGAGTGCCTGATGAGGCAGGCTTCGAGCAACAGAACCACACTTTAGAAGTGGATTCATCATCTCACAAGAACTATATTCCGGATGAGGCAGACTTTCTGCTGGGAATGGCTACGGTGAAGAACTGCGTTTCCTACCGAGATCCTGTGAATGGAACCTGGTATATTCAGTCACTTTGCCAGAGCCTGAGGGAAAGATGTCCTCAAGGAGATGACATTCTTAGCATCCTGACTGGCGT

Ensembl | nº de acceso | ratón

ENSMUSG00000026029

Nº de acceso NCBI

NM_009812

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CASP8(12370) , Casp8(12370)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
ZZU
KVR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

R Coriat et al.
Cell death & disease, 2, e191-e191 (2011-08-13)
Organotellurides are newly described redox-catalyst molecules with original pro-oxidative properties. We have investigated the in vitro and in vivo antitumoral effects of the organotelluride catalyst LAB027 in a mouse model of colon cancer and determined its profile of toxicity in
René Weiss et al.
Antiviral research, 123, 93-104 (2015-09-15)
New anti-viral agents and strategies are urgently needed to fight rapidly mutating viruses, as vaccine programs cannot react fast enough to prevent pandemics. Recently, we have shown that interleukin-24 (IL-24) sensitizes tumor cells to toll-like receptor 3 (TLR3) mediated apoptosis.
Meng Yu et al.
Molecular carcinogenesis, 53(7), 505-513 (2013-01-30)
Activation of telomerase is a key element in oncogenesis and resistance to apoptosis for many cancers. Some histone deacetylase inhibitors (HDACi) or chemotheraputic agents have been reported to downregulate the expression of human telomerase reverse transcriptase (hTERT). However, whether hTERT
Kei-Ichi Ishikawa et al.
PloS one, 9(4), e94645-e94645 (2014-04-12)
Mutations in p150glued cause hereditary motor neuropathy with vocal cord paralysis (HMN7B) and Perry syndrome (PS). Here we show that both overexpression of p150glued mutants and knockdown of endogenous p150glued induce apoptosis. Overexpression of a p150glued plasmid containing either a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico