Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU030721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ttr

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTTCACAGCCAACGACTCTGGCCATCGCCACTACACCATCGCAGCCCTGCTCAGCCCATACTCCTACAGCACCACGGCTGTCGTCAGCAACCCCCAGAATTGAGAGACTCAGCCCAGGAGGACCAGGATCTTGCCAAAGCAGTAGCATCCCATTTGTACCAAAACAGTGTTCTTGCTCTATAAACCGTGTTAGCAGCTCAGGAAGATGCCGTGAAGCATTCTTATTAAACCACCTGCTATTTCATTCAAACTGTGTTTCTTTTTTATTTCCTCATTTTTCTCCCCTGCTCCTAAAACCCAAAATTTTTTAAAGAATTCTAGAAGGTATGCGATCAAACTTTTTAAAGAAAGAAAATACTTTTTGACTCATGGTTTAAAGGCATCCTTTCCATCTTGGGGAGGTCATGGGTGCTCCTGGCAACTTGCTTGAGGAAGATAGGTCAGAAAGCAGAGTGGACCAACCGTTCAAT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Clase de riesgo para el agua (WGK)

WGK 1

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nádia P Gonçalves et al.
Acta neuropathologica communications, 2, 177-177 (2014-12-19)
Transthyretin V30M mutation is the most common variant leading to Familial Amyloidotic Polyneuropathy. In this genetic disorder, Transthyretin accumulates preferentially in the extracellular matrix of peripheral and autonomic nervous systems leading to cell death and dysfunction. Thus, knowledge regarding important
Ole B Suhr et al.
Orphanet journal of rare diseases, 10, 109-109 (2015-09-05)
Transthyretin-mediated amyloidosis is an inherited, progressively debilitating disease caused by mutations in the transthyretin gene. This study evaluated the safety, tolerability, pharmacokinetics, and pharmacodynamics of multiple doses of patisiran (ALN-TTR02), a small interfering RNA encapsulated within lipid nanoparticles, in patients

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico