Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EMU020771

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Unc84a

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATGAAGTGCGTCTCTCCAACTTGGAAGATGTTCTTAGAAAACTGACAGAAAAATCTGAGGCTATCCAGAAGGAGCTGGAAGAAACCAAGCTGAAAGCAGGCAGCAGGGATGAAGAGCAGCCCCTCCTTGACCGTGTGCAGCACCTAGAACTGGAACTGAACCTGTTGAAGTCACAGCTGTCAGACTGGCAGCATCTGAAGACCAGCTGTGAGCAGGCTGGGGCCCGCATCCAGGAGACTGTGCAGCTCATGTTCTCTGAGGATCAGCAGGGCGGTTCCCTCGAGTGGCTATTAGAGAAGCTTTCTTCTCGGTTCGTGAGCAAGGATGAGCTGCAGGTGCTCTTACATGACCTTGAGCTGAAACTGCTGCAGAATATCACACACCACATCACCGTGACAGGACAGGCCCCGACATCCGAGGCTATTGTGTCTGCCGTGAATCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hawa-Racine Thiam et al.
Nature communications, 7, 10997-10997 (2016-03-16)
Cell migration has two opposite faces: although necessary for physiological processes such as immune responses, it can also have detrimental effects by enabling metastatic cells to invade new organs. In vivo, migration occurs in complex environments and often requires a
Ping Li et al.
Nucleic acids research, 43(20), 9874-9888 (2015-10-18)
Nuclear export of messenger ribonucleoproteins (mRNPs) through the nuclear pore complex (NPC) can be roughly classified into two forms: bulk and specific export, involving an nuclear RNA export factor 1 (NXF1)-dependent pathway and chromosome region maintenance 1 (CRM1)-dependent pathway, respectively.
T Kuga et al.
Oncogenesis, 3, e94-e94 (2014-03-19)
The majority of human cancer shows chromosomal instability (CIN). Although the precise mechanism remains largely uncertain, proper progression of mitosis is crucial. B-type lamins were suggested to be components of the spindle matrix of mitotic cells and to be involved

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico