Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU018761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Furin

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGAGCCAAGAGGGACGTGTATCAGGAGCCCACGGACCCCAAGTTCCCCCAGCAGTGGTACCTGTCTGGTGTCACTCAGCGAGACCTGAATGTGAAGGAGGCCTGGGCCCAGGGCTTCACAGGCCATGGCATTGTGGTCTCCATCCTGGATGACGGCATTGAGAAGAATCATCCCGACCTAGCAGGCAATTATGACCCTGGAGCCAGTTTTGACGTGAATGACCAGGACCCCGACCCACAGCCTCGGTACACACAGATGAATGACAACAGGCATGGCACTCGCTGTGCCGGGGAAGTGGCAGCAGTGGCCAACAATGGTGTCTGTGGCGTAGGTGTAGCTTACAATGCCCGAATTGGAGGGGTGCGGATGTTGGATGGCGAGGTGACTGATGCAGTAGAGGCACGTTCGCTGGGCCTGAATCCCAACCACATCCACAT

Ensembl | nº de acceso | ratón

ENSMUSG00000030530

Nº de acceso NCBI

NP_001074923

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... FURIN(18550) , Furin(18550)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Diana Farhat et al.
British journal of cancer, 122(6), 885-894 (2020-01-29)
Breast cancer is the second most common cancer in the world. Despite advances in therapies, the mechanisms of resistance remain the underlying cause of morbidity and mortality. Lipoic acid (LA) is an antioxidant and essential cofactor in oxidative metabolism. Its
Z Zhou et al.
Cell death & disease, 4, e593-e593 (2013-04-20)
The multinucleated syncytial trophoblast, which forms the outermost layer of the placenta and serves multiple functions, is differentiated from and maintained by cytotrophoblast cell fusion. Deficiencies in syncytial trophoblast differentiation or maintenance likely contribute to intrauterine growth restriction and pre-eclampsia
Xiaokui Yang et al.
PloS one, 8(2), e50479-e50479 (2013-02-19)
Folliculogenesis is tightly controlled by a series of hormones, growth factors and cytokines, many of which are secreted as proproteins and require processing by proteases before becoming functional. Furin is a member of the subtilisin-like proteases that activate large numbers
Jian Shang et al.
Proceedings of the National Academy of Sciences of the United States of America, 117(21), 11727-11734 (2020-05-08)
A novel severe acute respiratory syndrome (SARS)-like coronavirus (SARS-CoV-2) is causing the global coronavirus disease 2019 (COVID-19) pandemic. Understanding how SARS-CoV-2 enters human cells is a high priority for deciphering its mystery and curbing its spread. A virus surface spike
Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico