Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU013351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fgfr4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51
En este momento no podemos mostrarle ni los precios ni la disponibilidad

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAAACACGTCGTCATCAACGGCAGCAGCTTCGGCGCCGACGGTTTCCCCTACGTACAAGTCCTGAAGACAACAGACATCAATATCTCGGAGGTACAGGTCTTGTATCTGAGGAACGTGTCCGCTGAGGATGCAGGAGAGTATACCTGTCTGGCGGGCAACTCCATCGGCCTTTCCTACCAGTCAGCGTGGCTCACGGTGCTGCCAGAGGAAGACCTCACGTGGACAACAGCAACCCCTGAGGCCAGATACACAGATATCATCCTGTATGTATCAGGCTCACTGGTTCTGCTTGTGCTCCTGCTGCTGGCCGGGGTGTATCATCGGCAAGTCATCCGTGGCCACTACTCTCGCCAGCCTGTCACTATACAAAAGCTGTCCCGTTTCCCTTTGGCCCGACAGTTCTCTTTGGAGTCGAGGTCCTCTG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Susagna Padrissa-Altés et al.
Gut, 64(9), 1444-1453 (2014-11-25)
Fibroblast growth factors (Fgfs) are key orchestrators of development, and a role of Fgfs in tissue repair is emerging. Here we studied the consequences of inducible loss of Fgf receptor (Fgfr) 4, the major Fgf receptor (Fgfr) on hepatocytes, alone
Jing Yang et al.
Cell cycle (Georgetown, Tex.), 14(20), 3318-3330 (2015-09-18)
Fibroblast growth factors (FGF1, FGF2 and FGF4) and fibroblast growth factor receptors (FGFR1, FGFR2, FGFR3 and FGFR4) have been reported to be expressed in preimplantation embryos and be required for their development. However, the functions of these molecules in trophectoderm
Shuxin Han et al.
Nature communications, 6, 7231-7231 (2015-06-05)
Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico